ID: 1045388925

View in Genome Browser
Species Human (GRCh38)
Location 8:101695750-101695772
Sequence ATGTTCTCCTTTTAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045388920_1045388925 7 Left 1045388920 8:101695720-101695742 CCTTCCATTTACCTTGAATTCAC 0: 1
1: 0
2: 4
3: 31
4: 291
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data
1045388921_1045388925 3 Left 1045388921 8:101695724-101695746 CCATTTACCTTGAATTCACACCC 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data
1045388922_1045388925 -4 Left 1045388922 8:101695731-101695753 CCTTGAATTCACACCCAGAATGT 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data
1045388917_1045388925 29 Left 1045388917 8:101695698-101695720 CCCAACCTCTCTCATATCACTTC 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data
1045388918_1045388925 28 Left 1045388918 8:101695699-101695721 CCAACCTCTCTCATATCACTTCC 0: 1
1: 0
2: 4
3: 36
4: 383
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data
1045388919_1045388925 24 Left 1045388919 8:101695703-101695725 CCTCTCTCATATCACTTCCTTCC 0: 1
1: 3
2: 3
3: 45
4: 499
Right 1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045388925 Original CRISPR ATGTTCTCCTTTTAGATGTG AGG Intronic
No off target data available for this crispr