ID: 1045390853

View in Genome Browser
Species Human (GRCh38)
Location 8:101712955-101712977
Sequence ATGTATACACTGTTGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12479
Summary {0: 3, 1: 116, 2: 7238, 3: 3367, 4: 1755}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045390853 Original CRISPR ATGTATACACTGTTGATTTG GGG (reversed) Intronic
Too many off-targets to display for this crispr