ID: 1045398090

View in Genome Browser
Species Human (GRCh38)
Location 8:101782297-101782319
Sequence ATGGCTACTCACACCTACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045398088_1045398090 -8 Left 1045398088 8:101782282-101782304 CCAGCTAAAGTTAAAATGGCTAC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1045398090 8:101782297-101782319 ATGGCTACTCACACCTACGGAGG No data
1045398087_1045398090 -7 Left 1045398087 8:101782281-101782303 CCCAGCTAAAGTTAAAATGGCTA 0: 1
1: 0
2: 0
3: 13
4: 245
Right 1045398090 8:101782297-101782319 ATGGCTACTCACACCTACGGAGG No data
1045398085_1045398090 6 Left 1045398085 8:101782268-101782290 CCTACGGATATAACCCAGCTAAA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1045398090 8:101782297-101782319 ATGGCTACTCACACCTACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045398090 Original CRISPR ATGGCTACTCACACCTACGG AGG Intronic
No off target data available for this crispr