ID: 1045398162

View in Genome Browser
Species Human (GRCh38)
Location 8:101782959-101782981
Sequence GGATACTGCATGAGTAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045398162_1045398167 19 Left 1045398162 8:101782959-101782981 CCTATATTACTCATGCAGTATCC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1045398167 8:101783001-101783023 GGATGAGATGGGATATATCCCGG No data
1045398162_1045398165 7 Left 1045398162 8:101782959-101782981 CCTATATTACTCATGCAGTATCC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1045398165 8:101782989-101783011 CTGAAATATCTTGGATGAGATGG No data
1045398162_1045398166 8 Left 1045398162 8:101782959-101782981 CCTATATTACTCATGCAGTATCC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1045398166 8:101782990-101783012 TGAAATATCTTGGATGAGATGGG No data
1045398162_1045398164 -2 Left 1045398162 8:101782959-101782981 CCTATATTACTCATGCAGTATCC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1045398164 8:101782980-101783002 CCTACTTAGCTGAAATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045398162 Original CRISPR GGATACTGCATGAGTAATAT AGG (reversed) Intronic
902164490 1:14559195-14559217 GGATACTGCATGTGTAGAGTTGG + Intergenic
904204861 1:28847531-28847553 GGATACTGAAAGAATAATAAAGG + Intronic
905603809 1:39278304-39278326 GGAAACTGGATGAGAAAAATGGG - Intronic
908453731 1:64281592-64281614 AGATACTGCAGGAGTAATAAGGG - Intergenic
909398363 1:75195888-75195910 GAATACTTCATGGGGAATATAGG - Intergenic
910488487 1:87742341-87742363 GGAGACTGGATGAGGCATATTGG + Intergenic
912233107 1:107818275-107818297 GGATACTGATTGATTAGTATTGG - Intronic
916936150 1:169630227-169630249 TGATAATGCAAGAGTAATGTTGG + Intergenic
917988341 1:180346078-180346100 GCATACTGGATGAGGGATATAGG + Intronic
1064657850 10:17573844-17573866 GGACACTGCAGGAGTAATTAAGG + Intergenic
1081953523 11:47068229-47068251 GAAAACTGCATGTGTAATTTTGG + Intronic
1087164626 11:94989418-94989440 GGATACTGCAGCAGTAACAGTGG - Intronic
1087867091 11:103243108-103243130 GGATACTCCTTTAGTAATATTGG + Intronic
1092552495 12:9518618-9518640 GAATACTGCATTAGTTCTATAGG - Intergenic
1094519622 12:31171994-31172016 GAATACTGCATTAGTTCTATAGG + Intergenic
1094659558 12:32454216-32454238 TCACACTGGATGAGTAATATGGG + Intronic
1097160622 12:57044151-57044173 GGATACTTCATGATTCAGATAGG + Exonic
1099691784 12:85963911-85963933 GGATACTTCAAGAGTAAAATGGG + Exonic
1100968754 12:100043820-100043842 GGCAACAGCATGAATAATATGGG - Intronic
1102577528 12:113865610-113865632 AGATAATGCATGAGAAGTATAGG - Intronic
1103824352 12:123724577-123724599 GTATACTGCATGAAGATTATTGG + Intronic
1105898256 13:24736082-24736104 GGAAGCTGCATGAGTAGTGTGGG + Intergenic
1107273285 13:38646091-38646113 GGATACTGGAAGAGTTAAATAGG - Intergenic
1108389005 13:49929432-49929454 AAATACTGCATCAGTAATGTGGG - Intronic
1110306537 13:73994204-73994226 GGAAGCAGCAAGAGTAATATGGG + Intronic
1111662452 13:91228183-91228205 GGATACTGAAAGCATAATATTGG - Intergenic
1112337372 13:98526274-98526296 GGAAAATGCCTGAGTCATATTGG - Intronic
1112936938 13:104812477-104812499 GGAAACTGTATAAGTTATATTGG + Intergenic
1117148584 14:52861636-52861658 GTATACTACATGAGGAATTTCGG + Intronic
1119433847 14:74585462-74585484 GGATTCTGCATCAGTAAGGTGGG - Intronic
1120135837 14:80866869-80866891 GTATCCTGCATGAGTAAAATGGG - Intronic
1120716028 14:87841617-87841639 GGAAACTGCATGTGGAGTATAGG - Intronic
1123165034 14:106318366-106318388 TGATACTGCATGAGAAAGATTGG + Intergenic
1126683828 15:51229851-51229873 GCATACTGCATTAATCATATTGG + Intronic
1130556076 15:84923472-84923494 AGATACTGAATGAGTAATGAAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136359145 16:29766617-29766639 AGATTCTGCAGGAGTAACATGGG + Intergenic
1141339398 16:83189008-83189030 TCATCCTGCATTAGTAATATGGG + Intronic
1146124121 17:30218660-30218682 GGAGACTGCTTGAGTAATTAAGG - Intronic
1150261502 17:63795872-63795894 TGATACTGCATAAGGAATATGGG - Intronic
1151011254 17:70499646-70499668 TAATACTGCATGAGTAATTGAGG + Intergenic
1151306691 17:73267195-73267217 AGATTCTGCATTAGTAAAATGGG + Intergenic
1153803499 18:8692082-8692104 GGAAATTGCATGAGTAAGAAAGG - Intergenic
1157010285 18:43640087-43640109 GAATACAGCATGAGAAATCTTGG - Intergenic
1157987474 18:52455491-52455513 GGTTTCTGCATGTGTAACATAGG + Intronic
1158254320 18:55528760-55528782 AGAATCTGAATGAGTAATATGGG + Intronic
1164002505 19:21115913-21115935 GAATACTCAATGAGTAAAATAGG - Intronic
924994666 2:348249-348271 AGATACTGTATGAGAAGTATAGG - Intergenic
926296285 2:11571365-11571387 GGAAACAGCAGGAGTAATTTAGG - Intronic
929100792 2:38311366-38311388 GGAGACTGTGTGAGTTATATTGG - Intronic
930815612 2:55594241-55594263 GGGTATTGCATGAGTAATGGTGG - Intronic
932035544 2:68242738-68242760 GCATACTGCATGCCTAAAATAGG + Intronic
935490536 2:103715100-103715122 GGATTCTGCATCAGGCATATTGG + Intergenic
937033281 2:118759046-118759068 GGATCCTGGCTGAGTAATCTTGG - Intergenic
940012485 2:149069588-149069610 GGATACTGCATGAGCCAGCTTGG + Intronic
946905531 2:224412619-224412641 GGATAATACATGAGAAAAATGGG + Intergenic
1169539969 20:6588954-6588976 GCATATTGCATGAGAATTATAGG - Intergenic
1169979303 20:11365394-11365416 GGAGACTGCATGTGAAACATTGG + Intergenic
1171987496 20:31670738-31670760 GGAGACAGCATGAGCAAAATGGG + Intronic
1173763970 20:45589187-45589209 AGATATTGCATGATGAATATGGG - Intergenic
1173993369 20:47319804-47319826 GGATCCTGCCTCAGTAAAATTGG - Intronic
1175480102 20:59304649-59304671 AGATGCTGCAGGAGTCATATTGG + Intronic
950609195 3:14114403-14114425 AGAGACTGCATGAGTAAACTGGG - Intronic
952728131 3:36610592-36610614 AGATACTGCAGGATTAAAATTGG + Intergenic
956388792 3:68749485-68749507 TGATACTGCATAATTATTATGGG + Intronic
958832742 3:99109534-99109556 GGTTACTTAATGAGTACTATTGG + Intergenic
959173054 3:102867523-102867545 GGCTACTGCCTGAGAAATATGGG - Intergenic
960205293 3:114890310-114890332 AGATTCTGTATGAGGAATATAGG - Intronic
963563991 3:146904349-146904371 GGATACTGAATAATAAATATTGG - Intergenic
964291531 3:155186193-155186215 GGATAATGCATGAGGAATTGGGG + Intergenic
965319137 3:167230038-167230060 GGATGCTGCATTACAAATATAGG - Intergenic
965661525 3:171046787-171046809 GGACACTGCATGAGTTAGGTTGG - Intergenic
970683990 4:18544364-18544386 AGAAGCTGGATGAGTAATATTGG + Intergenic
979782286 4:124668172-124668194 GGATACTTCATTAATAATATAGG - Intronic
987613883 5:20247204-20247226 TGATACTCCATGAGTATTTTTGG + Intronic
1007800311 6:44386805-44386827 GGAGACTGCATGAGTAATTGGGG + Intergenic
1008185256 6:48381703-48381725 TGATACTTCATGAGTAGTACAGG - Intergenic
1008669123 6:53748729-53748751 GGCTCCTGCATGATCAATATGGG + Intergenic
1023422886 7:40002234-40002256 GAATACTTTATGTGTAATATTGG - Intronic
1027838827 7:83280355-83280377 GGAAACTTCATGAATACTATGGG + Intergenic
1041228270 8:55722723-55722745 GTATACTGCTGGAGTAATAGGGG + Intronic
1043546134 8:81317843-81317865 GGTTACTGCATGTATAAAATTGG - Intergenic
1044691831 8:94888326-94888348 GGATACTGAATGGTTAACATTGG + Intronic
1045014700 8:97990454-97990476 GCATAATGAATGAGTCATATGGG - Intronic
1045398162 8:101782959-101782981 GGATACTGCATGAGTAATATAGG - Intronic
1048857333 8:138696020-138696042 GGAAACTGCAAAAGTCATATGGG - Intronic
1049103312 8:140594996-140595018 GGATAGTGCATGAGAAAAAATGG + Intronic
1052833351 9:33233155-33233177 GGAAACAGCATGAGTAATGAAGG + Intronic
1060260150 9:122067444-122067466 AGATTCTGCAGCAGTAATATTGG - Intronic
1187394808 X:18910132-18910154 GGATACTGCAGGAAAAAGATGGG - Intronic
1193373288 X:80725200-80725222 GGATACTACATGAACAATATAGG + Intronic
1194969556 X:100328022-100328044 GGATCCTAGATGATTAATATTGG + Intronic
1195751358 X:108164123-108164145 GGGTGCTGCATGAGAACTATTGG + Intronic
1200538643 Y:4431193-4431215 GGACACTGCAGGAGCGATATTGG - Intergenic