ID: 1045398463

View in Genome Browser
Species Human (GRCh38)
Location 8:101785637-101785659
Sequence CTGGGTTAGTACAGGGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045398455_1045398463 23 Left 1045398455 8:101785591-101785613 CCATTAAGATTGGGGGCTATTTA No data
Right 1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045398463 Original CRISPR CTGGGTTAGTACAGGGAAGA CGG Intronic
No off target data available for this crispr