ID: 1045402613

View in Genome Browser
Species Human (GRCh38)
Location 8:101834278-101834300
Sequence CAGCCCCAGCAGGGGGACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045402613_1045402621 3 Left 1045402613 8:101834278-101834300 CCGGTGTCCCCCTGCTGGGGCTG 0: 1
1: 0
2: 1
3: 32
4: 394
Right 1045402621 8:101834304-101834326 TCACCCAGCTGCCCCAGGAATGG No data
1045402613_1045402629 28 Left 1045402613 8:101834278-101834300 CCGGTGTCCCCCTGCTGGGGCTG 0: 1
1: 0
2: 1
3: 32
4: 394
Right 1045402629 8:101834329-101834351 TGCAAGCTGAGCCCCACCCAGGG No data
1045402613_1045402628 27 Left 1045402613 8:101834278-101834300 CCGGTGTCCCCCTGCTGGGGCTG 0: 1
1: 0
2: 1
3: 32
4: 394
Right 1045402628 8:101834328-101834350 CTGCAAGCTGAGCCCCACCCAGG No data
1045402613_1045402619 -2 Left 1045402613 8:101834278-101834300 CCGGTGTCCCCCTGCTGGGGCTG 0: 1
1: 0
2: 1
3: 32
4: 394
Right 1045402619 8:101834299-101834321 TGGCCTCACCCAGCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045402613 Original CRISPR CAGCCCCAGCAGGGGGACAC CGG (reversed) Intronic
900086397 1:899885-899907 CAGCCCAGGAAGTGGGACACTGG + Intergenic
900188299 1:1343033-1343055 CCCCCCCAGCATGGGGACAGTGG + Intronic
900228879 1:1545987-1546009 CAGTCCCAGGAAGGGGCCACAGG + Intronic
900435500 1:2628935-2628957 CAGCCCCGGCTGGGGACCACCGG - Intronic
900472194 1:2860492-2860514 CAGCCCTAGCCGGGGGCCAAAGG + Intergenic
902234881 1:15050902-15050924 CAGGTCCAGCAGGGAGGCACCGG - Intronic
902691218 1:18110927-18110949 CGGCCCCAGCCGGGGGTCTCCGG + Intronic
902923048 1:19678783-19678805 CAGCCCAGGCATGGGGACAGGGG + Intronic
903049040 1:20587417-20587439 CAGCCCCAGCAGGAGGCAATAGG + Intergenic
903300333 1:22374367-22374389 CAGACCCTGCAGGGGGAACCAGG + Intergenic
903344825 1:22677336-22677358 CCGCCCCAGGAGGGGGACCCAGG + Intergenic
903554779 1:24185600-24185622 CAGTCCCAGCTAGAGGACACAGG - Intronic
905180225 1:36160971-36160993 CAGCCCCAGCAGGGCTGCCCAGG - Intronic
905385865 1:37603643-37603665 CAGCCCCTGCAGTGGGGCATGGG + Intergenic
906206675 1:43990962-43990984 CAGCCCCAGGAGGGGACCAGAGG + Exonic
906688128 1:47775547-47775569 CGGGCCCAGCAGGGGCACCCTGG - Intronic
907280090 1:53341720-53341742 CAGCCCCAGCCTGGGGACCCAGG + Intergenic
908124193 1:61013846-61013868 GAGCTAGAGCAGGGGGACACTGG + Intronic
908356817 1:63330279-63330301 CAGCCCTAGCACGAGGACCCCGG + Intergenic
908497134 1:64705792-64705814 CAGCCACACCAAGGGGACACAGG + Intergenic
911100075 1:94088567-94088589 CAGCCACAGAAAGGGCACACAGG - Intronic
911370522 1:96989470-96989492 CAGCCCCAGCAGAGGGGAATGGG + Intergenic
911656648 1:100451317-100451339 CAGCTACAGCAGGGAGACAGTGG - Intronic
912505095 1:110150764-110150786 CAGCCCCAGCCGGGGGCCTGTGG + Exonic
915338926 1:155165942-155165964 CAGCCTCTGCAGGGGGCCAGGGG - Intergenic
915443621 1:155962073-155962095 CAGGCCCAGGAGAGGGCCACTGG - Intronic
916231870 1:162548832-162548854 CTGACCCAGCAGGGGCACAAAGG - Intergenic
916844518 1:168635699-168635721 CAGCACCAGCAGTGGGAAGCAGG + Intergenic
919690456 1:200524080-200524102 CATGCCCAGCAAGGGGACACTGG - Intergenic
922714475 1:227859792-227859814 CAGGCCCCACAGGGGCACACGGG + Intergenic
922717663 1:227885683-227885705 CAGCCCCTGCAGGGTCACAAGGG - Intergenic
922796297 1:228341394-228341416 CAGCACAGGGAGGGGGACACGGG - Intronic
922831766 1:228557821-228557843 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922832246 1:228609803-228609825 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922832806 1:228612044-228612066 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922833367 1:228614285-228614307 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922833927 1:228616526-228616548 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922834484 1:228618767-228618789 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922835038 1:228620982-228621004 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922835595 1:228623202-228623224 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922836153 1:228625444-228625466 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922836711 1:228627683-228627705 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922837270 1:228629925-228629947 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922837831 1:228632166-228632188 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922838389 1:228634406-228634428 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922838947 1:228636631-228636653 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922839507 1:228638872-228638894 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922840068 1:228641103-228641125 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922840628 1:228643344-228643366 GACCCCCAGCAGGAGGACCCCGG + Intergenic
922841191 1:228645575-228645597 GACCCCCAGCAGGAGGACCCCGG + Intergenic
923837997 1:237635826-237635848 CAGCTACAGCAAGGGGACAAGGG - Intronic
1062878176 10:958501-958523 CATCCCCAGCAAGGCTACACAGG - Intergenic
1063231218 10:4067390-4067412 GAGCCCAAGGAGGGGGTCACAGG + Intergenic
1064429339 10:15257570-15257592 CAGCCCCAGCAGATAGACCCTGG - Intronic
1067077501 10:43196575-43196597 CAGACACTGCATGGGGACACAGG - Intronic
1067791173 10:49288847-49288869 CGGCCCCAGCAGGGAGGCAGAGG - Intergenic
1068637370 10:59362608-59362630 CACCCCCAGCAGGGGCCCAGCGG + Intronic
1069370916 10:67746926-67746948 CAGCACCAGCAGGGGAAAAATGG - Intergenic
1069708703 10:70475528-70475550 CTGCCACAGCTGAGGGACACTGG - Intergenic
1069712719 10:70500304-70500326 CAGCCCCACTAGGTGGACACAGG + Intronic
1069788348 10:71004109-71004131 CTTCCCCAACAGGAGGACACAGG - Intergenic
1069841138 10:71340111-71340133 CTGCCCCAGCAGGAGGGCCCTGG - Intronic
1069919941 10:71810419-71810441 CCACCACAGCAGGGGGCCACAGG - Intronic
1072550045 10:96470246-96470268 CATCCCCAGCCGGGGGTCAGAGG + Intronic
1073328018 10:102653664-102653686 CAGCCCCCTCAGTGGGACCCAGG - Intronic
1074363212 10:112839024-112839046 CAGCCCAAGGAGGGGGCCATGGG + Intergenic
1074492941 10:113955296-113955318 AGGCCCCAGCTGTGGGACACTGG - Intergenic
1075555270 10:123426443-123426465 CAGCCCCAGCAGGGTGTCTAAGG + Intergenic
1075556352 10:123435332-123435354 CTGCCCCAGCAGGAGGCCTCGGG + Intergenic
1076094558 10:127720674-127720696 CAGCCACAGCAAGAGGGCACTGG + Intergenic
1076294772 10:129375844-129375866 CAGCTCCAGCAGGGAGGGACTGG - Intergenic
1076582343 10:131520208-131520230 CAGCCTCACCAGGAAGACACTGG + Intergenic
1076616980 10:131761560-131761582 CACCCACAGCAGGGAAACACAGG + Intergenic
1076851638 10:133096165-133096187 CAGGCCCAGGAGGGGGCCTCGGG - Intronic
1077194323 11:1271910-1271932 CAGCACCAGCAGGGTGCCCCAGG - Intergenic
1077228409 11:1448231-1448253 CAGCTCCTGCAGGTGGGCACAGG - Intronic
1077433249 11:2526409-2526431 CAGTCCCAGCAGCGGGACTATGG + Intronic
1077499634 11:2903317-2903339 CAGGCGCAGCAGGGAGACCCAGG - Exonic
1077901192 11:6490332-6490354 CAGCTCCAGCACGGAGACACAGG + Intronic
1078132545 11:8624742-8624764 CAGCCCCATCTCTGGGACACAGG + Exonic
1078631674 11:13009459-13009481 CAGCCGCCGGAGGGGGGCACGGG + Intergenic
1079122284 11:17694894-17694916 CAGCCCCAGCAGGTGGGAGCCGG - Intergenic
1083487688 11:62993727-62993749 CAGGCCCAGCCAGAGGACACAGG - Intronic
1083620345 11:64046246-64046268 AAGCCCCAGAAGAGGGACAGGGG + Intronic
1083660201 11:64248535-64248557 CAGCCCCAGCTGTGTGACCCCGG - Intergenic
1084176386 11:67424513-67424535 GAGGCCCAGCAGGCGGAGACGGG - Exonic
1084641666 11:70429967-70429989 CTGCCCCTGCAGGGCCACACAGG + Intronic
1084768275 11:71326283-71326305 CAGCCCCTGCGGGTGGCCACAGG + Intergenic
1085408244 11:76276832-76276854 CAGCCCTGGCAGGGGGTCTCTGG + Intergenic
1087688343 11:101290540-101290562 GAGCCCCAGCCAGGGGCCACTGG - Intergenic
1088818302 11:113436069-113436091 CGGCTCCAGCAGGCTGACACCGG + Intronic
1089032326 11:115345117-115345139 CAGCCCCTGCTGTGGGACAAAGG - Intronic
1090660061 11:128875739-128875761 CTGCCCCAGAAGGAGGCCACAGG - Intergenic
1091369074 11:135043839-135043861 CAGGCCCTGCAGGGAGACTCAGG - Intergenic
1091756607 12:3056515-3056537 CAGCCCCAGCCTGTGGTCACTGG + Intergenic
1093503339 12:19836700-19836722 CAGCCCCGCGAGGGGGACAAGGG + Intergenic
1094832365 12:34306210-34306232 CAGCCCCTGCGCGGGGACATGGG + Intergenic
1094834893 12:34317712-34317734 CAGCCCCTGCACGGGGCCCCAGG - Intergenic
1094836184 12:34323184-34323206 CAGCCCATGCACGGGGACCCAGG - Intergenic
1094837430 12:34328705-34328727 CAGCCCCATAGTGGGGACACGGG - Intergenic
1095416933 12:41987482-41987504 CATCCCAAGCAGGGGGACTCTGG + Intergenic
1095979573 12:47963782-47963804 CAGCCCCAGGAGGCGGGCTCAGG - Intronic
1096122559 12:49097656-49097678 CACCCCCAGCTGGAGGTCACTGG + Exonic
1096514780 12:52149776-52149798 CTGGCCCAGCCAGGGGACACAGG + Intergenic
1096688921 12:53307605-53307627 CACCCCCAGCAGGGGGTTCCTGG + Exonic
1097053574 12:56237628-56237650 CAGCCCCTGCAGGAGCACATGGG - Exonic
1097522775 12:60689392-60689414 GAGCCCCAGCAGAGGGACCCTGG + Intergenic
1102514238 12:113435622-113435644 CAGTCCCAGCCGGTGGAGACGGG + Intronic
1102919830 12:116783522-116783544 CAGCTCCTGCAAGGCGACACAGG + Intronic
1103965665 12:124637878-124637900 CAGCCACCCCAGGGGGACGCTGG + Intergenic
1104892196 12:132145432-132145454 CAGCCTCCGCAGGTGGAAACAGG - Intronic
1105402242 13:20105876-20105898 CAGCCCCAGCTGGAGGAGGCTGG - Intergenic
1107579574 13:41768185-41768207 CACTACCAGCTGGGGGACACAGG + Intronic
1108692405 13:52871191-52871213 CAGCACTAGCAGGAGGACAGAGG - Intergenic
1109908956 13:68885360-68885382 CAGTCACAGCAGTGTGACACTGG + Intergenic
1110597352 13:77333934-77333956 CAGCCCCAGCTTGTGGACCCTGG + Intergenic
1112857437 13:103788222-103788244 CAGCCCCACCAGGTGGCCTCTGG + Intergenic
1114183226 14:20382306-20382328 CTGCAGCAGCAGGGGGACAGTGG + Exonic
1114454679 14:22847027-22847049 CAAGCCAAGCAGGGGGCCACAGG + Exonic
1115307409 14:31946708-31946730 GAGCCCCAGCAGCTGGACCCTGG + Intronic
1116682765 14:47995735-47995757 GAGCCCCAGCAAGGTGACAGAGG - Intergenic
1116947328 14:50847942-50847964 GAACCCCAGAAGGGGGTCACTGG - Intergenic
1120686508 14:87544029-87544051 CATTCCAAGCAGGGTGACACTGG - Intergenic
1121466093 14:94116339-94116361 CAGCCCCTGCTGAGGGTCACTGG + Intronic
1122152832 14:99734058-99734080 CAGCTCCAGCCAGTGGACACTGG + Intergenic
1122462448 14:101906844-101906866 CAGCCCCGGCGGGGGCACAGTGG + Intronic
1122548131 14:102536056-102536078 CAGCCCCAGCAGCCGGGCAGTGG + Intergenic
1122840352 14:104459065-104459087 CATCTCCAGCGGGGGAACACCGG + Intergenic
1124120158 15:26882264-26882286 CAGCCCCAGCAGGGTGGCCCGGG - Intronic
1124345998 15:28922092-28922114 CAGCTCCACCAGGAGGACAGAGG - Intronic
1124412056 15:29444842-29444864 CAGTCCCTGGAGGGGGGCACTGG + Intronic
1125477128 15:40054965-40054987 CATCCCCAGCAGCTGGACAGAGG - Intergenic
1125937536 15:43649387-43649409 CCGCCACAGCAGGGGCCCACAGG - Intronic
1125950436 15:43746807-43746829 CCGCCGCAGCAGGGGCCCACAGG - Intronic
1126156996 15:45574678-45574700 CAGCTACAGCAGGGAGGCACTGG - Intergenic
1127626055 15:60781372-60781394 AAGCCCCAGCACGAGGACTCTGG - Intronic
1128423941 15:67521084-67521106 CACCCCCAGCGGGAGGCCACGGG + Exonic
1129753854 15:78084201-78084223 CAGCCCCAGCAAGGGAGCCCAGG + Intronic
1129771934 15:78208189-78208211 CAGCACCCCCAGGGGGACACTGG + Intronic
1129794216 15:78363702-78363724 CAGGCCCAACAGTGGGACTCCGG + Intergenic
1131072939 15:89477310-89477332 CACCCACAACATGGGGACACCGG + Intronic
1131536304 15:93240649-93240671 AAGCCAAAGCAGGGGTACACTGG + Intergenic
1131972183 15:97903965-97903987 CAGCGCCAGCAGAGAGACAGTGG + Intergenic
1132547536 16:540261-540283 CAGCCGCTGCCGGGGGACCCGGG - Intronic
1132562100 16:600272-600294 CCTCCCCACCAGGAGGACACAGG - Intronic
1132981831 16:2742318-2742340 CAGACCCAGGAGGCAGACACCGG + Intergenic
1133270506 16:4608969-4608991 CAGCCCCAGCAGGCAGGCGCTGG + Exonic
1133325109 16:4937322-4937344 CACCCCCAGCCGGGGGACTCCGG + Intronic
1133781477 16:8942309-8942331 CAGCCCCAGCATGGGAATCCTGG + Intronic
1135414399 16:22257779-22257801 CAGGCCAAGCAGGGTCACACTGG - Intronic
1136269328 16:29139243-29139265 CAGGCTCAGCAAGGGGGCACTGG - Intergenic
1136453018 16:30365001-30365023 CAGCTCCTGCAGTGGGACAGTGG + Exonic
1138505449 16:57476071-57476093 GAGCCCCAGCCTGGGGACACCGG + Intronic
1138530425 16:57631560-57631582 CACCCCCAGCATGGGGACGGGGG - Intronic
1138539314 16:57678983-57679005 CAGCCCAAGCAGGAGACCACTGG + Intronic
1138675027 16:58645020-58645042 CAGTGACAGCAGGGGGCCACTGG + Intergenic
1139429605 16:66904114-66904136 CTGCCTCAGCAGGGGGAATCTGG + Intergenic
1139660770 16:68419275-68419297 CAGTCCCTGCAGTGGGACCCTGG - Intronic
1142148015 16:88500533-88500555 CAGCACCAGCAAGGTGACAGCGG - Intronic
1142272739 16:89099177-89099199 CCGCCCCAGGATGCGGACACAGG - Intronic
1142560065 17:804564-804586 CAGCCGGGCCAGGGGGACACAGG - Intronic
1143152997 17:4818651-4818673 CAGAATCAGGAGGGGGACACGGG - Intronic
1143386132 17:6531718-6531740 CAGCCCCAGCAAGGAGAGAGGGG - Intronic
1143875527 17:9987939-9987961 GAGCCCCAGCAGGAGGCCACTGG - Intronic
1145265650 17:21378464-21378486 CAGCTCTAGGAGGGGGACCCTGG + Intronic
1146633233 17:34485351-34485373 AAGCCCCAGCAGGCTGACAGGGG - Intergenic
1147160981 17:38569314-38569336 CAGCCTCAGCAGGGAGACAGAGG + Intronic
1147673434 17:42189829-42189851 CTGCCCCACCAGGTGGACTCTGG + Exonic
1147674084 17:42192961-42192983 CAGACCCAGCAGGAAGACAGTGG - Exonic
1148772704 17:50076393-50076415 CAGCCCCAGCCGGGGGCGATCGG - Exonic
1149231863 17:54544377-54544399 CAGCTCCAGCAGGGGAAAAATGG - Intergenic
1149543440 17:57485823-57485845 CGGCCAGAGCAGGGGGTCACTGG - Intronic
1149884447 17:60327282-60327304 CAGCTGCAGCAGGGAGACACAGG + Intronic
1150389279 17:64781275-64781297 CCGCCCCAGCACGGAGACAAGGG + Intergenic
1151319526 17:73344048-73344070 CAGCCCCTGCAGAGAGACCCTGG - Intronic
1151791058 17:76306332-76306354 AAGCCCCAGCAGGGGAGCCCTGG - Intronic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1152227950 17:79101447-79101469 CAGCCCCAGGGCTGGGACACTGG + Intronic
1152237984 17:79148378-79148400 AGGCCCCAGCAGTGGGGCACAGG - Intronic
1152396323 17:80035794-80035816 CGGCCCCCGCAGCGGGACCCGGG - Exonic
1152567597 17:81107113-81107135 CAGCCCCAGCATGCCGACACAGG - Intronic
1152676778 17:81645305-81645327 CAGCCCCAGCATGGGGTCTGCGG - Exonic
1152749767 17:82057251-82057273 CAGCCCCAGGGAGGGCACACAGG - Exonic
1152762290 17:82115113-82115135 CAGCCCCAGCTGGTGGAATCAGG - Intronic
1153263833 18:3248257-3248279 CAGCTGCAGCAGGGGGACAACGG - Intronic
1153668771 18:7390941-7390963 CAGGCCAAGCAGGGCCACACGGG + Intergenic
1155309296 18:24508732-24508754 CAGCCCCAGAAGGGGCACAGTGG - Intergenic
1157280632 18:46344534-46344556 CACCCCCAGCGTGGAGACACTGG + Intronic
1157741429 18:50096805-50096827 GAGCTCCAGCAGGAAGACACTGG - Intronic
1157914840 18:51654828-51654850 CAGCCCCAGCTGGGTGCCGCAGG - Intergenic
1158609722 18:58928182-58928204 CAGCCCCAGCTGGTGCTCACAGG - Intronic
1159784016 18:72692764-72692786 CAGCCCCGGCAGGGAGGGACGGG - Intergenic
1160785092 19:896615-896637 GAGGACCAGCATGGGGACACAGG + Exonic
1160881263 19:1321820-1321842 CAGGGCCAGCTGGGAGACACAGG - Intergenic
1160889532 19:1369891-1369913 CAGCCACAGCAGGGACACGCTGG - Intronic
1160946659 19:1646967-1646989 CAGCCCTGGTAGGGGGACACTGG - Intronic
1161084757 19:2329683-2329705 CAGCCACAGCAGAGGGATAGCGG - Intronic
1161128540 19:2574148-2574170 CAGGCCCAGCAGGGACACCCCGG - Intronic
1162152336 19:8655383-8655405 CAGCCCCACCAGGAGGGTACAGG - Intergenic
1162387064 19:10365942-10365964 CAGGCCCAGCTGGGTGACACAGG + Intronic
1162762455 19:12896792-12896814 CACCCCACGCAGGGGGACTCAGG - Intronic
1163133666 19:15293315-15293337 TAGACCCAGCAGGGTGGCACCGG + Intronic
1163228110 19:15979262-15979284 CAGACATAGCAGGGGGACATTGG + Intergenic
1163437333 19:17303296-17303318 CGGCGCCAGCAGGCGGACGCTGG - Exonic
1163816142 19:19465661-19465683 CAGCCCCAACCTGGGCACACTGG - Intronic
1166531089 19:43544005-43544027 CATGCCCAGCAGGTGGGCACAGG - Intronic
1166748336 19:45152500-45152522 CAGCAGCAGCAGGGGGACTTTGG - Exonic
1166840769 19:45695654-45695676 CAGCTCCAGCAGCAGGGCACAGG - Exonic
1168684355 19:58338955-58338977 CAGCACCAGCGGGTGCACACGGG + Exonic
925759215 2:7168194-7168216 CGGCCCTAGCTGGGGGCCACAGG + Intergenic
925886970 2:8401698-8401720 CAGTCCCAGCATAGGCACACAGG + Intergenic
926212378 2:10880451-10880473 CGGCCGCAGAACGGGGACACAGG + Intergenic
926220225 2:10931324-10931346 TGGCCCCAGAATGGGGACACAGG + Intergenic
926243132 2:11103329-11103351 CAGCCCCAGCGTGTGGACAATGG - Intergenic
926686815 2:15704480-15704502 CAGGCACAACAGAGGGACACTGG - Intronic
927103082 2:19802722-19802744 CAGACCCAGCTGGAGGACAAAGG - Intergenic
927939806 2:27096329-27096351 CAGCCCAGGCAGGGGGTCGCGGG + Intronic
929455138 2:42059950-42059972 CAGCCCCTGGAGAGGGACAGAGG + Intergenic
932435208 2:71699328-71699350 CAGCCCCAGCTGGGGGAGGAGGG - Intergenic
934766875 2:96884655-96884677 GAGCCCCAGCAGTGTGGCACTGG + Intronic
934936819 2:98471776-98471798 CAGCCCCAACAGGGGTTCTCGGG - Intronic
935266889 2:101402540-101402562 CAGCCCCAGCATGGAGCCACTGG - Exonic
937150197 2:119681138-119681160 CAGCCCCAGCAGGGAGTCTTGGG - Exonic
937261013 2:120586880-120586902 CAGCCCCAGCAGGGGGTAGGAGG + Intergenic
937370413 2:121293672-121293694 CAGTCTCTGCAGGGGGCCACGGG + Intergenic
937886644 2:126903820-126903842 CAGCAGCAGCAGGGAGACTCAGG + Intergenic
938489607 2:131754805-131754827 CAGCCCCTGCACTGGGACCCGGG + Intronic
939079499 2:137642577-137642599 CAGCTGTAGCAGGGGGTCACTGG - Exonic
941812315 2:169767461-169767483 CAGCCCCATCTGGTGGACACAGG + Intronic
942277317 2:174332815-174332837 AAAGCCCAGCAGGGGGACCCGGG - Intergenic
942558725 2:177198573-177198595 CAGCCGCAGGAGGGGCACGCTGG - Intergenic
944307773 2:198196975-198196997 CACCCCCAGTAGGGGAAGACTGG + Intronic
944763375 2:202840289-202840311 CAGCTGCAGGAGGGGCACACTGG + Intronic
946147350 2:217741092-217741114 CAGCCCTGGCAGGAGGGCACTGG + Intronic
946275640 2:218629668-218629690 TAGCCCCAGGATGGGGACACTGG + Intronic
947904100 2:233747227-233747249 CAGCCACAGCAGGGGAACCTGGG - Intronic
948270507 2:236670002-236670024 CAGCCCCAGCAGGGAGGGAGGGG - Intergenic
948364458 2:237445808-237445830 GAGCCCCAGGGCGGGGACACTGG + Intergenic
948616461 2:239202447-239202469 CAGACCCAGCGGGGTGACTCTGG + Intronic
948742464 2:240056828-240056850 CAGGCCCAGCAGCCGGTCACTGG + Intergenic
949023177 2:241752770-241752792 CACCCCCAGGAGGGCGACCCTGG + Intronic
949073442 2:242040419-242040441 CCGCCCATGCTGGGGGACACAGG + Intergenic
949077584 2:242070822-242070844 CAGCCCCAGCAGGGCGCCGTGGG + Intergenic
1169483476 20:6006355-6006377 CAGCCCAAGCAGCAGGGCACGGG - Exonic
1170829859 20:19830774-19830796 CAGCCCCTGCAGGGGTACCTTGG + Intergenic
1172045895 20:32079911-32079933 CAGCCCCAGCTGGGGCACCTCGG - Intronic
1172175395 20:32969209-32969231 CAGCCCAAGGACGGGGACATGGG + Intergenic
1173221770 20:41137504-41137526 CGGCTCCTGCAGGCGGACACGGG - Exonic
1173342049 20:42161602-42161624 CAGGCCAAGCTGGGGGAGACAGG - Intronic
1174550799 20:51360162-51360184 CAGGACCAGCAGGTGGTCACAGG + Intergenic
1175264650 20:57695335-57695357 CAGCCCCAGCCAGGGGGCCCAGG - Intronic
1175707861 20:61194491-61194513 CAGCCCCAGCAAGGGAATCCAGG - Intergenic
1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG + Intronic
1175854517 20:62113327-62113349 CACCCCCAGCAGGGTGTCCCAGG - Intergenic
1175988610 20:62776685-62776707 CAGCCTCAGCTGGGGGTCACAGG + Intergenic
1175995822 20:62811958-62811980 CCTCCCCACCAGGGGGACTCGGG + Intronic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176233935 20:64045490-64045512 CAGCCCAAACAGGGAGGCACTGG + Intronic
1176239271 20:64068419-64068441 CAGACCCAGCAGGGGGCCTTGGG - Intronic
1176247507 20:64104475-64104497 CGGCCACAGCAGGGGGGTACAGG + Intergenic
1176247521 20:64104524-64104546 CAGACACAGCAGGGGGGCACAGG + Intergenic
1176247532 20:64104573-64104595 CGGCCACAGCAGGGGAGCACAGG + Intergenic
1176247556 20:64104661-64104683 CAGACACAGCAGGGGGGTACAGG + Intergenic
1176247582 20:64104759-64104781 CGGCCACAGCAGGGGGGCACAGG + Intergenic
1176247596 20:64104808-64104830 CGGCCACAGCAGGGGGGTACAGG + Intergenic
1176247611 20:64104857-64104879 CGGACACAGCAGGGGGGCACAGG + Intergenic
1176827507 21:13714557-13714579 CAGACCCAGCAGTGTGGCACAGG + Intergenic
1178977642 21:37233153-37233175 CGGCCTCAGCTGGGGGACTCTGG + Intronic
1179402083 21:41093795-41093817 CACCATCAGCAGGGTGACACTGG - Intergenic
1179681176 21:43022273-43022295 CAGCCCCAGCGGAGGCACCCTGG - Intronic
1179961914 21:44772432-44772454 CAGACCCAGCAGAGGGCCAGGGG - Intronic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182123074 22:27799384-27799406 CGGCCCCAGCAGGGCGAGGCGGG - Exonic
1183661724 22:39225317-39225339 CAGGCCAAGCAGAGAGACACAGG + Intronic
1183736645 22:39648283-39648305 CAGGCCCGGCATGCGGACACAGG + Intronic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184130366 22:42513625-42513647 CAGCACCAGGAGTGGGCCACAGG + Intronic
1184140544 22:42575453-42575475 CAGCACCAGGAGTGGGCCACAGG + Intergenic
1184464128 22:44659086-44659108 CAGCCCCAGAAGTGTGACAAAGG - Intergenic
1184489796 22:44801965-44801987 CAGCCCGAGCTGGGAGGCACAGG - Intronic
1184649109 22:45911589-45911611 CACCCCCAACAGGAGGACGCCGG + Intergenic
1185205578 22:49535960-49535982 GAGCCCCAGGAGAGGGACAAGGG + Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
952556218 3:34534309-34534331 CAGGCCCAGAATTGGGACACTGG + Intergenic
952852901 3:37743793-37743815 CAGCCCCAGCAGGGAAGCACTGG + Intronic
953574892 3:44105098-44105120 CAGCCTGAGCTGGGAGACACTGG - Intergenic
953702831 3:45210138-45210160 CAGCCCCTGCAGGAGACCACTGG - Intergenic
954392951 3:50276899-50276921 CAGCCCCGGGAGGGCGGCACAGG + Intronic
954422920 3:50428045-50428067 GAGCCACAGCAGGGAGATACTGG - Intronic
956374871 3:68603534-68603556 CAGCACCAGCAGGAGAAAACTGG - Intergenic
959252955 3:103971932-103971954 CAGCTCTATCAGGTGGACACAGG - Intergenic
960574693 3:119218253-119218275 CACTCCCTGCAGGGGGACACTGG + Intronic
961206985 3:125092098-125092120 CACCCCCAACAGGGAGACCCAGG + Exonic
961342260 3:126235134-126235156 CACCCTCAGAAGGGGCACACTGG + Intergenic
961491992 3:127262806-127262828 CCCCCCCAGCTGAGGGACACAGG + Intergenic
962360654 3:134740165-134740187 CAGTCCCTGCAAGGGGTCACTGG - Intronic
964702667 3:159586261-159586283 CAGCACCAGCAGGGGAGCAAAGG + Intronic
965032894 3:163396351-163396373 AAGCCCCAGCAGAGGGGAACAGG - Intergenic
965731325 3:171774988-171775010 CAGCTGCAGCTGGGGGACAGTGG + Intronic
966354375 3:179063961-179063983 TAGCCCCAGCTTGGGAACACTGG + Intronic
966826848 3:183972074-183972096 CAGGCCCATCAAGGGGTCACGGG + Intronic
967867703 3:194204049-194204071 CGGCCCCAGCAGGAGGCCCCTGG + Intergenic
968059305 3:195714875-195714897 CAGCCACAGCAGGGGCCAACTGG - Intergenic
968477147 4:817216-817238 AAGGCTCAGCAGGGGCACACTGG + Intronic
968660611 4:1797339-1797361 CAGCCCCTGCTGGGGTACCCTGG + Intronic
968744327 4:2351811-2351833 CAACCCCAGAAGGGGGCCATGGG - Intronic
968873862 4:3255026-3255048 CAGCCCCAGTTGGGGGCCAGGGG - Intronic
968922047 4:3527350-3527372 CATTCCCAGCAGGAGGACCCAGG + Intronic
969264230 4:6054696-6054718 CAGACCCAGCTGGGAGACGCTGG + Intronic
969922876 4:10557367-10557389 AAGCCCCAACAGGAGGTCACAGG + Intronic
972745084 4:41924565-41924587 CAGCCCCAGCAGAGCCACAGTGG - Intergenic
977726157 4:100299349-100299371 GAGCCCCAGCTGTGGGACAAAGG - Intergenic
981711094 4:147709676-147709698 CAGCCCAAGCAGCGGCCCACGGG + Intergenic
982055845 4:151548189-151548211 CAGCACCAGCACTGGGACCCAGG + Intronic
983009090 4:162522583-162522605 CAGCCCCAGGATGGGGACTGTGG + Intergenic
983831081 4:172329286-172329308 TAGCCCCAGCAGGGGGTGGCTGG + Intronic
984141732 4:176012389-176012411 CAGACCCTGCAGTGGGGCACTGG - Intergenic
984749567 4:183258654-183258676 CAGCCTTACCAGGGAGACACAGG + Intronic
985788602 5:1913115-1913137 CCATCCCTGCAGGGGGACACTGG + Intergenic
985873374 5:2576982-2577004 CAGCCCCAGCAGACCGTCACAGG + Intergenic
986723686 5:10578499-10578521 CAGGACCCGCATGGGGACACAGG + Intronic
987080137 5:14418717-14418739 GAGTCCCTGCAGGGGGACAGTGG + Intronic
988443607 5:31259860-31259882 AGGCCCCAGCAGGGGAGCACAGG + Intronic
989166449 5:38437510-38437532 CAGCCCAGGCTGGGAGACACTGG - Intronic
991454975 5:66793292-66793314 GTGTCCCAGCAGGCGGACACTGG - Intronic
992164036 5:74031081-74031103 CAGCCCCGGTGGGGGGAGACTGG - Intergenic
993013318 5:82508543-82508565 GAGCCCCAGCAGGGTGAGAAGGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993902397 5:93593530-93593552 CAGCCACAGGAGGGAGAGACAGG - Intronic
996956281 5:129187046-129187068 CAGCCACTGCCGGGGGACAGTGG - Intergenic
997522545 5:134532450-134532472 AACCCCCAGCATGGAGACACAGG - Intronic
997759036 5:136427173-136427195 CCACCACATCAGGGGGACACAGG - Intergenic
998026873 5:138824680-138824702 CAGCTGCAGCAGGCGGTCACAGG + Exonic
999128076 5:149261365-149261387 CAGCCTCAACAGGGGGAACCAGG + Intergenic
999266349 5:150269345-150269367 CAGTCCCAGCAGGGTGGGACAGG + Intronic
1001051003 5:168414477-168414499 CAGCCCCCGCAAGTGGACCCAGG + Exonic
1002058958 5:176615151-176615173 GAGCCCCAGCCTGGGCACACAGG + Intergenic
1006389862 6:33751905-33751927 CTGCCCCTGCATGTGGACACAGG + Intergenic
1006425549 6:33960764-33960786 CAGCCCCAGCAGTGGGAGCTGGG + Intergenic
1007390683 6:41548014-41548036 TCGCCCCAGTTGGGGGACACAGG - Intronic
1008359556 6:50599296-50599318 CAGGCCCAGCCAGGGGGCACTGG - Intergenic
1012315039 6:97775107-97775129 CAGCGCCAGCAGGGGAAAAATGG - Intergenic
1013381218 6:109573234-109573256 CTGCCCCAGCACTGGCACACAGG - Intronic
1013720571 6:113022358-113022380 CAGGCCCAGAAGGGGTTCACTGG + Intergenic
1018068125 6:160137807-160137829 CAACCCCAGCAAGGGAACCCAGG - Intronic
1018686365 6:166307593-166307615 CGGCCCTAGCCGGGAGACACGGG + Exonic
1018971132 6:168530210-168530232 CAGCCACAGCGGAGGGAAACGGG + Intronic
1018987661 6:168649859-168649881 CTGCCCCAGTAGCTGGACACAGG - Intronic
1019150182 6:170000484-170000506 CAGCGCAAGCAGAGGGACATGGG - Intergenic
1019258099 7:64433-64455 CTGCCCCAGCAGAGGGACAAAGG + Intergenic
1019269598 7:139629-139651 CAGCCCCAGCCGCGGTGCACAGG + Intergenic
1019323309 7:425273-425295 CCTCCCCAGCAACGGGACACAGG - Intergenic
1020187672 7:5971271-5971293 CAGCCCCATCTGGGGGTGACGGG + Intergenic
1020295245 7:6753499-6753521 CAGCCCCATCTGGGGGTGACGGG - Intergenic
1021186956 7:17575903-17575925 CAACACCAGCAGGGGGAAAATGG - Intergenic
1022987692 7:35674994-35675016 GAACCCCAGGAGGGGGTCACGGG + Intronic
1023908057 7:44536175-44536197 CAGGGCCAGGATGGGGACACAGG + Intronic
1024512577 7:50215312-50215334 CAGCTCCAGCATGGGGACCTAGG - Intergenic
1024529707 7:50381558-50381580 CAGCTCCAGAATGGAGACACAGG + Intronic
1024872663 7:53983999-53984021 CTGCCCCAGCGAGGGGAGACAGG - Intergenic
1024889001 7:54179979-54180001 CATTCCCAGAAAGGGGACACTGG + Intergenic
1026878473 7:73893523-73893545 CAGCCCCCGCAGGAGGAGGCTGG + Intergenic
1027992164 7:85376587-85376609 CATCCCCAGCAGGATGACATTGG + Intergenic
1028522974 7:91752720-91752742 CAGTCCCAGCAGGGGAAAAATGG - Intronic
1029421946 7:100476488-100476510 CACCCCCACCATGGGGACCCAGG + Intronic
1031969529 7:128054087-128054109 CAGCCCCAGAAAGGAGACCCAGG - Intronic
1032084524 7:128877054-128877076 CAGCCCCAGCCGGGAGCCCCAGG - Exonic
1032780582 7:135162305-135162327 AAGCCCCAGCAGGGAGTCCCAGG - Intronic
1034272732 7:149811218-149811240 CAGCCCCAGGAGGCTAACACAGG - Intergenic
1034889571 7:154827919-154827941 CATCCCCAACAGGGAGAAACTGG - Intronic
1035106426 7:156445229-156445251 CAGCCCCAGGAGATGAACACAGG - Intergenic
1035403728 7:158585915-158585937 CAACCCCAGCAAGAGGCCACTGG + Intronic
1035536139 8:392707-392729 CAGCCCCAGCAGGGCGCCGTGGG + Intergenic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036728596 8:11242184-11242206 CAGCCTCAGCAGACGAACACAGG + Intergenic
1037249604 8:16877148-16877170 CAGCACCAGCAAGGGGAAAATGG + Intergenic
1038261752 8:26002169-26002191 CAGCCCCAGAAGTGGGATCCTGG - Intronic
1038346609 8:26737836-26737858 CAGCTGCAGCAGCAGGACACGGG + Intergenic
1041277570 8:56178705-56178727 CAGCCCTAGGACGGGGAGACTGG - Intronic
1042771522 8:72387757-72387779 CAGCAGCAGCAAAGGGACACAGG + Intergenic
1045383180 8:101646909-101646931 CAGGCCCAGCAGGGGAACGGTGG + Intronic
1045402613 8:101834278-101834300 CAGCCCCAGCAGGGGGACACCGG - Intronic
1048223470 8:132564099-132564121 CACCACCAGCAGGGGGTCAGGGG + Intergenic
1048364856 8:133729864-133729886 CAGCCCCAGCGTGGGTGCACAGG - Intergenic
1048507402 8:135033896-135033918 CTGCCCCATGAGGAGGACACAGG - Intergenic
1048950120 8:139489757-139489779 CAGCCCCTGCAGAAGGAAACAGG + Intergenic
1049218262 8:141417590-141417612 CAGCCCCATGAGGGGGCCAGGGG + Intronic
1049679228 8:143910100-143910122 CAGCCACAGAAGGGAAACACTGG - Intergenic
1049867162 8:144946630-144946652 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867262 8:144947030-144947052 CAGGCCCAACAGCAGGACACAGG - Intronic
1051590918 9:18776482-18776504 AAGGCCCAGCAGGGAGACATTGG + Intronic
1052766986 9:32651118-32651140 TAGCCCCAGCAGGGGGTGGCTGG - Intergenic
1053104249 9:35396815-35396837 CAGCCACAGCAGGAGAACAGGGG - Intronic
1053484634 9:38442566-38442588 GAGCCCTGGAAGGGGGACACTGG + Intergenic
1053509142 9:38672526-38672548 CAGACCCAGCAGGGGGCAGCAGG - Intergenic
1054464157 9:65483058-65483080 CAGGCCCCGCAGGGCGGCACGGG + Intergenic
1055632304 9:78236582-78236604 CAGCCCTGGCTGGGGGACACAGG + Exonic
1056667168 9:88590014-88590036 AAGGCCCAGCAGGGAGCCACTGG + Intergenic
1057241677 9:93417007-93417029 CAGCTCCGGCAGGGGAAAACCGG + Intergenic
1057442156 9:95090638-95090660 CAACCCCAGCAGGGAGGCAGGGG - Intergenic
1057824316 9:98360446-98360468 CACACCCTGCAGGGAGACACAGG + Intronic
1057825401 9:98369129-98369151 CAGCCACAGCTGAGGAACACTGG + Intronic
1059561669 9:115340573-115340595 CAGTAACAGCAGGGGGACAGGGG + Intronic
1060827357 9:126694759-126694781 CAGCCCCAGGAGGGGCAGAGGGG - Intronic
1060879559 9:127108532-127108554 GTGCCCCAGCAGCGGGTCACGGG - Exonic
1061034993 9:128108450-128108472 CAACCCCAGCAGGGGCGCAGCGG + Exonic
1061532867 9:131228585-131228607 TAGCCCCAGCAGGAGAACAGGGG - Intronic
1061673256 9:132201182-132201204 CAACCCCAGCAGGGTGACCTGGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061929897 9:133827074-133827096 CAGTGCCAGGAGGGGGACAGAGG + Intronic
1062289623 9:135788716-135788738 GAGCCCCAGCTGGGGGACGAAGG - Intronic
1062319651 9:135984521-135984543 CAGCCACAGGATGGGGACACGGG - Intergenic
1062340381 9:136091422-136091444 CAGGCCCAGCAAGCAGACACTGG + Intronic
1062488519 9:136792835-136792857 GAGCTCCAGCAGGGGCACAGAGG + Exonic
1062507573 9:136886066-136886088 GAGCCCAAGCCGGGCGACACCGG - Intronic
1062514464 9:136925650-136925672 GAGCCCCAGGGAGGGGACACAGG - Intronic
1062712421 9:137983873-137983895 CAGACACACCAGGAGGACACAGG - Intronic
1203519849 Un_GL000213v1:34983-35005 CAGACCCAGCAGTGTGGCACAGG - Intergenic
1188879992 X:35480748-35480770 CATCCACAGCAGAGGGACATTGG + Intergenic
1197747223 X:129939737-129939759 CAGCCCCAGCTGGGGAGTACAGG - Intergenic
1199157640 X:144569468-144569490 CATCCCCAGCAGTGGGACACTGG - Intergenic
1199792980 X:151172233-151172255 CAGCTCCACCTGGGGGAGACGGG + Intergenic
1200923779 Y:8636276-8636298 CAGCCCAAGCAGAGCCACACCGG - Intergenic
1200964068 Y:9020457-9020479 CAGCCCAAGCAGAGCCACACAGG + Intergenic
1202175468 Y:22094949-22094971 CAGCCCAAGCAGAGAAACACAGG + Intronic
1202215894 Y:22491434-22491456 CAGCCCAAGCAGAGAAACACAGG - Intronic
1202379278 Y:24261568-24261590 CATTCCCAGCAGGGGGAGAAAGG - Intergenic
1202491504 Y:25408553-25408575 CATTCCCAGCAGGGGGAGAAAGG + Intergenic