ID: 1045408114

View in Genome Browser
Species Human (GRCh38)
Location 8:101888033-101888055
Sequence CAGTCCCAGTGAAAGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045408112_1045408114 3 Left 1045408112 8:101888007-101888029 CCAAGAGGACAGTGTCAGCGTCA 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045408114 Original CRISPR CAGTCCCAGTGAAAGTTCTG AGG Intronic
No off target data available for this crispr