ID: 1045409881

View in Genome Browser
Species Human (GRCh38)
Location 8:101906215-101906237
Sequence CTGTAAGAAGTGAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045409881 Original CRISPR CTGTAAGAAGTGAGGGAAAT GGG (reversed) Intronic
900626160 1:3609664-3609686 CTGTTTGAAGTGGTGGAAATGGG - Intronic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
903134457 1:21300323-21300345 CTCTTAGAGGTGAGGAAAATGGG - Intronic
903696705 1:25212781-25212803 CTGTAAGAAGGGAGGAAATGAGG - Intergenic
903746606 1:25591109-25591131 CTGAAGGAAGTGAGGAAAAGAGG - Intergenic
903955105 1:27020094-27020116 CTGTAAAATGGGAGTGAAATAGG + Intergenic
906939038 1:50239459-50239481 TTTTAAGAAGGGAGGGGAATGGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907935517 1:59038434-59038456 CTGAAGGGCGTGAGGGAAATAGG + Intergenic
907944581 1:59123594-59123616 CTGAAGAAAGTGAGGGGAATTGG + Intergenic
908831632 1:68184855-68184877 CTGTAAGAGCTGAGGAAAAGAGG - Intronic
910593248 1:88950854-88950876 CTGTAAGGACTGAGTGAGATAGG - Intronic
910867124 1:91798851-91798873 CTGTAGGGAATAAGGGAAATAGG + Intronic
911004214 1:93200601-93200623 TTGGAAGAAGTCAGGGGAATGGG + Intronic
911154225 1:94623240-94623262 ATGTAAGCACTCAGGGAAATAGG + Intergenic
911201620 1:95050345-95050367 ATTTAAAAAGTGAGGAAAATTGG + Intronic
911502812 1:98709719-98709741 CTGTAAAAAGTGAGATAAATGGG - Intronic
911641996 1:100299441-100299463 CTGTAAGAGTTTAGAGAAATTGG + Intergenic
912271936 1:108220202-108220224 CTGTCAGAAGTGAGGGATGGGGG + Intergenic
913409770 1:118538286-118538308 CTTTAAGAGATGAGGGAAAAGGG - Intergenic
914459655 1:147871672-147871694 CTTTTAGGAGTGAAGGAAATGGG - Intergenic
915871617 1:159565721-159565743 CAATAAGAACTGAGGTAAATGGG - Intergenic
916782804 1:168054040-168054062 CTGAAATAAGTGAGGGAGATGGG - Intronic
916792219 1:168135435-168135457 CTGAAAGAAGTAACAGAAATGGG + Intronic
917016859 1:170541608-170541630 CTGTAAGAAGTGACAGTAATAGG + Intronic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917815630 1:178707042-178707064 GTGGAAGAAGAGAGGAAAATGGG + Intergenic
918163995 1:181926953-181926975 CTGCAAAAAGGGAGGGGAATTGG - Intergenic
918648353 1:186928245-186928267 ATGTAAGCTGTGAGGGAAACAGG + Intronic
918749310 1:188252109-188252131 TGGTAAGAAATGAAGGAAATCGG - Intergenic
919133522 1:193480402-193480424 CTGCAAGGAGTGGGGGAGATAGG + Intergenic
919613429 1:199775537-199775559 CTGTATGAAGTGAAAAAAATTGG + Intergenic
922945944 1:229514087-229514109 CGGTAACAACTGGGGGAAATTGG - Intergenic
923484701 1:234417817-234417839 CATTAAGAAGTAAGGGAAATAGG - Intronic
924209204 1:241747393-241747415 CTGTAAGCAATGGGGGAAGTTGG + Intronic
924743670 1:246813167-246813189 CTGAAAGAACTGATGGAAAAAGG + Intergenic
1063768265 10:9168216-9168238 GTGTAAAAAATGAGGAAAATGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064967749 10:21031784-21031806 CTGGAAGAAGTGAGTGAAGGAGG - Intronic
1067550707 10:47233703-47233725 CTTTAACAACTGAGGGGAATTGG - Intergenic
1067836490 10:49644704-49644726 TTGCAAAAAGTGAGGGAAAGGGG + Intronic
1068598198 10:58926895-58926917 GTAGAAGAAATGAGGGAAATAGG + Intergenic
1069388819 10:67910875-67910897 CTTTCATAAGTGAGGGAAAGAGG + Intronic
1069833890 10:71296734-71296756 CTGGCAGAGGTGAGGGAAGTCGG + Exonic
1069972185 10:72181262-72181284 TTGTAAGATGAGAGGCAAATAGG - Intronic
1070055728 10:72932780-72932802 AGGAAAGAAATGAGGGAAATGGG - Exonic
1070330212 10:75410905-75410927 CTATTATAAGTGAGGGTAATGGG - Intergenic
1071238328 10:83675659-83675681 CTATAAAAAGTGAAGGACATGGG - Intergenic
1071743363 10:88387578-88387600 CTGTAAGCAGTTACGTAAATAGG - Intronic
1072887255 10:99289077-99289099 CTGTAAGAAGTGACAAAAAATGG + Intergenic
1075364208 10:121869148-121869170 CTCAAATAAGTGATGGAAATGGG - Intronic
1078041900 11:7873219-7873241 CTTTAAGAAGTAGGGGAAAATGG - Intergenic
1078933056 11:15927922-15927944 CTGTAAGAAGTAATTGAAAAGGG - Intergenic
1079346925 11:19660872-19660894 CTCTAAAAATTGAGGGAAAGTGG + Intronic
1079719176 11:23789129-23789151 CTGCCAGAACTGAGGGAAATGGG + Intergenic
1079911825 11:26319318-26319340 ATGGAAGAAGAGAGGGAAAAAGG - Intronic
1080340254 11:31254732-31254754 CTGGAACAAGTGGGGCAAATTGG + Intronic
1080722027 11:34859190-34859212 CTGGAAGAAGTGTAGGAAATTGG + Intronic
1081588987 11:44407783-44407805 CTGGAAGAAGTGATTGACATGGG + Intergenic
1083066542 11:59929866-59929888 CCTTAAGCAGTGATGGAAATTGG + Intergenic
1083802912 11:65057291-65057313 CTGGAGGAAGTGAGGGGAAGGGG - Intronic
1085243754 11:75080443-75080465 CTGTAAGAGGTGGGGGCAGTAGG - Intergenic
1085835430 11:79950820-79950842 GTTGAGGAAGTGAGGGAAATCGG + Intergenic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1087259601 11:95995784-95995806 ATGATAGAAGTGAGGAAAATGGG - Intronic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1088270521 11:108029305-108029327 CTGTAAGGAGTGAAGGATAGAGG + Intronic
1088683956 11:112269438-112269460 ATGTAAGAAGTTAAGGATATAGG + Intronic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1090919834 11:131197957-131197979 CTGGATGAAGAGAGAGAAATAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091071685 11:132570721-132570743 CTGAAAGAACTCAGGGGAATAGG + Intronic
1091920464 12:4300146-4300168 CTTTTAGAAGTGAGAGAAAAAGG + Exonic
1092010363 12:5105374-5105396 CTGTAAGAAGGGAGGCTATTCGG + Intergenic
1092355286 12:7789517-7789539 CTGGAAGATGTTAGAGAAATAGG - Exonic
1092503680 12:9072967-9072989 ATTTAAGTAGTGAGGGAAGTAGG - Intronic
1092845936 12:12585331-12585353 CAGTAGGCAGTCAGGGAAATGGG + Intergenic
1093534709 12:20209755-20209777 CTGTAAGAAGGAAGGGAATGAGG + Intergenic
1093642946 12:21549188-21549210 CTGTAGTAAGTGGGAGAAATAGG - Intronic
1094133507 12:27099961-27099983 CTTTAAGAAGAGAGGGAATGAGG - Intergenic
1094626058 12:32125173-32125195 CTGTAAGAGATCAGGGACATTGG - Intronic
1095241462 12:39864626-39864648 ATGTAAGAAGGGAAGAAAATGGG - Intronic
1095376420 12:41534442-41534464 CTGTGAGGAGTGAGGGGAAGGGG - Intronic
1095612805 12:44150295-44150317 CTGTAAGAGATGAGAGAAACAGG + Intronic
1095634050 12:44410341-44410363 CAATAGGAACTGAGGGAAATAGG - Intergenic
1096501347 12:52065574-52065596 CTGTAAGAATTCAGGGAGGTAGG + Intergenic
1096814050 12:54190407-54190429 CAGGAAGAAGTGAGAGAAAAAGG + Intergenic
1096847581 12:54416528-54416550 AAGTAAGAAATGAGGGAACTAGG + Intronic
1097393231 12:59041061-59041083 TTGTAGGAGGTGAGGGAAACTGG - Intergenic
1097396625 12:59082871-59082893 CTGGAAGGGGTGAGGGAGATGGG - Intergenic
1097428234 12:59472798-59472820 CTGTAAGAGGGAAGGCAAATGGG + Intergenic
1097704754 12:62856373-62856395 CTGAAAGATGGGAAGGAAATGGG - Intronic
1097963693 12:65557099-65557121 GTTTAAGAAATGAGTGAAATGGG - Intergenic
1098054002 12:66484157-66484179 CTGTTAGAAGTTAGGATAATGGG - Intronic
1098076656 12:66738737-66738759 CTGTGAGAAGGAATGGAAATGGG + Intronic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1099277229 12:80592068-80592090 GGGTAAGAAGTGGAGGAAATAGG - Intronic
1099590806 12:84586862-84586884 CTGTAAGCATTGATGGTAATGGG + Intergenic
1101030695 12:100655846-100655868 CTTGAGGAAGTGAAGGAAATGGG + Intergenic
1101074567 12:101115289-101115311 CTTTAAGAAGTTACGTAAATCGG + Intronic
1101704815 12:107211781-107211803 CTGTAAGAGGGAAGGCAAATGGG + Intergenic
1101784509 12:107871425-107871447 CTTTAAGAGGTGATTGAAATTGG - Intergenic
1103639010 12:122333427-122333449 CTGAAGGAAGTGAGGGAATGGGG + Intronic
1104740150 12:131166014-131166036 CTGCTGGAAGTGGGGGAAATGGG + Intergenic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1107451873 13:40517117-40517139 CTGCACGAAGAGATGGAAATTGG + Intergenic
1108315503 13:49233147-49233169 ATGTAATAACTGAAGGAAATGGG + Intergenic
1109130093 13:58574391-58574413 CTGTTCCAAGTGAGAGAAATTGG + Intergenic
1109257743 13:60103784-60103806 CTGTCACAAGAGAGGGAATTAGG - Intronic
1109993676 13:70093225-70093247 CAAGATGAAGTGAGGGAAATAGG + Intronic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1116428783 14:44821645-44821667 CTGAAAGATGTGAGGAGAATGGG + Intergenic
1117896576 14:60493884-60493906 TTCCAAGAAGTGAGGGAAACTGG + Intronic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1118888070 14:69882934-69882956 ATTTAAGAAGTGTGAGAAATAGG + Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120108476 14:80524085-80524107 CTGTTAGAAGTAAGGTAACTAGG + Intronic
1123690686 15:22836240-22836262 CTGCAAAATGTGTGGGAAATTGG + Intergenic
1123802366 15:23834506-23834528 ATTTAAGAAGTAAGGTAAATAGG + Intergenic
1125032328 15:35085186-35085208 CTGGAAGATGTTAGAGAAATAGG + Intergenic
1126175665 15:45733157-45733179 CTGTAAGAAGTAAGGCAAGTAGG + Intergenic
1128340235 15:66817537-66817559 CTGTTAGAAGTGGAGGGAATTGG + Intergenic
1128896054 15:71375063-71375085 ATTTAGGAAGTGGGGGAAATGGG - Intronic
1129103555 15:73288999-73289021 CTGTAAGAAGTGAAATAAAGAGG - Intronic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129869826 15:78933095-78933117 CTGTTAGAAGGTGGGGAAATGGG - Intronic
1131029009 15:89170676-89170698 CTGGAAGAAGTGTGGGTAACAGG - Intronic
1132257662 15:100391331-100391353 GTGTAAGAAATGAGGTAAATAGG - Intergenic
1134272653 16:12746946-12746968 CTAAAAGAAGTGAGGAAAAGAGG + Intronic
1134362907 16:13549213-13549235 GTGTAGGAGGTTAGGGAAATGGG + Intergenic
1135110177 16:19684577-19684599 CTGTAAGGATTAAGGGAAAAAGG - Intronic
1135821541 16:25691036-25691058 CTCAGGGAAGTGAGGGAAATGGG - Intergenic
1139761684 16:69188928-69188950 CTCCAAGAAGTGATGGACATAGG + Intronic
1142074574 16:88110064-88110086 ATGTGAGGAGTGAGGGAAAAAGG - Intronic
1142330906 16:89452837-89452859 CTAAAAGTAGTGAGGGGAATAGG - Intronic
1143823526 17:9585336-9585358 CTAAAAGAAGTTGGGGAAATAGG - Intronic
1144082018 17:11771742-11771764 TAGTAAGAATTGAGGTAAATGGG - Intronic
1145862452 17:28222075-28222097 CTGTAAGTGGGGAGTGAAATTGG + Intergenic
1146552836 17:33796740-33796762 AAGTATGAAGTGAGGGAAAAAGG + Intronic
1146885593 17:36468663-36468685 ATGTGAGAAGTGAAGGAAAGGGG + Intergenic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151972902 17:77467963-77467985 GTGTAAGAACTGAGGGACCTAGG + Intronic
1153103160 18:1497419-1497441 CTTTAACAAGTAAAGGAAATGGG - Intergenic
1155053563 18:22167532-22167554 TTGTAAGCACTGACGGAAATGGG - Intergenic
1158124238 18:54083896-54083918 CTGAAACAAGTCAGGGCAATGGG - Intergenic
1158728058 18:59992921-59992943 CTGTAAAATGAGAGGGAAATGGG - Intergenic
1159076210 18:63684561-63684583 AAGTAAGAAGTGGGGGAATTGGG + Intronic
1159309345 18:66687428-66687450 CTCAAAGAAGGGAGGGAAAAAGG - Intergenic
1160118934 18:76109597-76109619 CTGTATTTAGTGAGAGAAATAGG + Intergenic
1161796036 19:6387343-6387365 GGGACAGAAGTGAGGGAAATGGG - Intronic
1162215126 19:9127716-9127738 CTGTAATGAGAAAGGGAAATTGG - Intergenic
1162232898 19:9282404-9282426 CAGTAAGTGTTGAGGGAAATAGG - Intergenic
1162850702 19:13429209-13429231 CTGCAAGAAGAGAGAGAAAGAGG - Intronic
1163199812 19:15759028-15759050 GTGTAACAAGGGAGGGATATCGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165167235 19:33865392-33865414 CTGTAAGATGGGAGGGATGTCGG - Intergenic
1165705817 19:37975506-37975528 CTGTAAGATGGGAGTGATATTGG + Intronic
1166766247 19:45253160-45253182 CTGTCGGAGGTGAGGGAAACAGG - Intronic
1167382559 19:49147063-49147085 CTGAAAGGAGTGAGGGACTTGGG + Intronic
1167830146 19:52012723-52012745 CTGAAAAAAGTGGGGGAAACGGG + Intergenic
925759862 2:7174179-7174201 GTGTAAGAAGTAATGGAAACAGG - Intergenic
926849845 2:17183725-17183747 ATGGAGGAAGTGATGGAAATGGG + Intergenic
927277996 2:21278113-21278135 CTGTAAAAATAGAGGGCAATAGG - Intergenic
927615258 2:24587419-24587441 TTGTAATTAGTGAGGGAGATAGG + Intronic
929332403 2:40698957-40698979 CTATTAGAAGTGAGGGTAAATGG - Intergenic
931312759 2:61097978-61098000 CTCTAAGAAGAGATGGAAAATGG - Intronic
931718719 2:65051037-65051059 CTGCAAGAGTTGAGGGGAATAGG - Intergenic
932222690 2:70011835-70011857 CTGTAAAGAGTGAGGGGAAGAGG + Intergenic
935231926 2:101106459-101106481 GTGCGAGGAGTGAGGGAAATAGG + Intronic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
939668569 2:144980793-144980815 CTGTAAGAAGATAGAGAAAAAGG - Intergenic
940139032 2:150473057-150473079 CTGAAAGGAGTGAGGGAGAGAGG - Intronic
940175458 2:150872957-150872979 CTGTGAGAAGGGAGGCAGATGGG - Intergenic
940370319 2:152894184-152894206 GTTTTAGAAGTGAGGTAAATAGG + Intergenic
942015568 2:171810609-171810631 TTGTAATAAGGGAGGGAATTTGG - Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942789287 2:179740354-179740376 CTGGAAGAAGTCAGGGACAGAGG + Intronic
943313821 2:186360739-186360761 CAGAAAGAAGTGAGGCATATTGG + Intergenic
943779042 2:191801042-191801064 CTGGAAGAAGTGAGGCATTTGGG + Intergenic
943894217 2:193332574-193332596 TTGTAAGAACTGCGGGAAAAAGG + Intergenic
944472147 2:200065329-200065351 CTGGGAAAAGTGAGGGCAATGGG - Intergenic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
945217365 2:207447982-207448004 CAGTAAGAAGAAAGGGAATTAGG - Intergenic
947229068 2:227867149-227867171 CAGAACGAAGTGAGTGAAATTGG - Intergenic
1170024785 20:11877147-11877169 CTGTCAGAAGTGAAGATAATTGG + Intergenic
1171023941 20:21611609-21611631 GTGTAAGAAGTAAGAGAAGTGGG + Intergenic
1171153208 20:22846147-22846169 CTGTCAAAAGTGAGTGGAATGGG - Intergenic
1171568199 20:26215786-26215808 ATGTTAAAAGTGAGGGAAATTGG + Intergenic
1172051039 20:32118385-32118407 TTTTAAGAAGTGAAGGAAATGGG - Intronic
1173175652 20:40762940-40762962 CAGCAAGAGGGGAGGGAAATGGG + Intergenic
1174954376 20:55080572-55080594 CAGTAATTAGTGTGGGAAATGGG - Intergenic
1178523060 21:33302459-33302481 TTGTAAGGAGTGAGGAAAGTAGG - Intergenic
1178963901 21:37096401-37096423 ATGTAAGAAGTGAAGGAACGGGG + Intronic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1180721308 22:17910825-17910847 CCTTAAGGAATGAGGGAAATGGG - Intronic
1182811825 22:33123243-33123265 CTGTAAAAAGAAAGGAAAATGGG - Intergenic
1183879533 22:40815496-40815518 CTGCAACAAGTGAAGGGAATGGG + Intronic
949583066 3:5410455-5410477 CTGAAAGAAGTGAAGGAATATGG + Intergenic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950230414 3:11271191-11271213 CTGCAAGAAGTGAGAGAGGTGGG - Intergenic
950279310 3:11692866-11692888 CTATAAGAAGTAATGAAAATAGG + Intronic
950284117 3:11731572-11731594 CTTAAAGCAGTAAGGGAAATGGG + Intergenic
950294808 3:11820037-11820059 ATTATAGAAGTGAGGGAAATGGG - Intronic
950329213 3:12143031-12143053 CTGTAGGTAGAGAGGGTAATGGG + Intronic
950422701 3:12908078-12908100 CTGGAAGAAGAAAGGGAAAATGG + Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950868927 3:16212507-16212529 CTTTAAGAACGGCGGGAAATAGG - Intronic
951356122 3:21668427-21668449 TTGTGAGACGTGAGGGATATAGG - Intronic
952661458 3:35854616-35854638 CTGAATGAAGAGAGAGAAATAGG + Intergenic
954100216 3:48366723-48366745 ATGTAACCATTGAGGGAAATTGG + Intergenic
955443062 3:58977893-58977915 CTGAAAGAAGTGTGGGAAGGAGG + Intronic
955452476 3:59084641-59084663 CTGTAAGATGGGTGGGAATTGGG - Intergenic
955539321 3:59957248-59957270 GTATAAGAAGAGAGGGAATTTGG + Intronic
956007134 3:64792166-64792188 GAGTAAGAAGGGAGAGAAATGGG + Intergenic
956098934 3:65747294-65747316 CTGTAAGATGAGAGTGAAAAGGG - Intronic
956606438 3:71077588-71077610 CTGTAGGAAGTCGGGGAAGTGGG - Intronic
956813093 3:72883816-72883838 ATATAAGAGGTGAGGGAAAGAGG + Intergenic
958115338 3:89208900-89208922 CTGCAAGAAGTAAGCAAAATGGG + Intronic
960493068 3:118340934-118340956 CTGTGAGAAGTGGGGAAAAAAGG + Intergenic
961572397 3:127809140-127809162 ATGTAGGGAGTGAGGGGAATTGG + Intronic
963017401 3:140839084-140839106 ATGTGAGAAGTCAGGGGAATGGG + Intergenic
963297837 3:143566185-143566207 GAGTAAGCAGTGAGGGAAAAGGG - Intronic
963323641 3:143836979-143837001 CAGTAAGATGCAAGGGAAATTGG - Intronic
963918815 3:150886427-150886449 CTGAAATGAGTGAGAGAAATGGG + Intronic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
964816816 3:160726777-160726799 CAGTAAGAAGATAGGGACATAGG - Intergenic
965599779 3:170443179-170443201 CTGTATGTAGCTAGGGAAATTGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966971323 3:185048122-185048144 CCGTATGAAGTGATGGACATGGG + Intronic
967988873 3:195116517-195116539 CAGCAAGAAGGGAGGGAACTTGG + Intronic
969894825 4:10293633-10293655 CTGTATGAAGTGGGGAAAAATGG - Intergenic
970557372 4:17248263-17248285 CTATGAGAAATGAGAGAAATGGG - Intergenic
971876089 4:32310185-32310207 ATATAAGATGTGAGGGAAAAAGG - Intergenic
972111745 4:35570322-35570344 CTGTAAGTAGGGAGGGAGTTGGG - Intergenic
973945953 4:55956000-55956022 GAGTCAGATGTGAGGGAAATTGG + Intronic
974545458 4:63300377-63300399 CTATATGAAGTGAAGGAAATTGG + Intergenic
974691512 4:65303475-65303497 CTGTAAGAAGTGAGTACACTTGG + Intergenic
976160945 4:82198401-82198423 CGGTAACAATTGAGGAAAATTGG - Intergenic
976805256 4:89038681-89038703 CTGTAATAAGTGACAGAAAGGGG + Intronic
977178444 4:93842848-93842870 AGGTAAGAAGGGAGGGAAAGGGG + Intergenic
977514659 4:98006405-98006427 CTGTGAGAAGTGAAGGCACTAGG + Intronic
977760655 4:100732717-100732739 CTGGAGGAAGTGAGGGCAAAGGG + Intronic
977909360 4:102514375-102514397 CTGTAAGAAGTGATGGGATTAGG + Intronic
978995647 4:115148390-115148412 CTGATAGAGCTGAGGGAAATTGG + Intergenic
979019007 4:115470590-115470612 ATTTAAGTAGTGAGGAAAATGGG + Intergenic
979875676 4:125887927-125887949 TTGTAAGAAGTGAAGGAAAAGGG - Intergenic
979952189 4:126907068-126907090 CTGCAAAAAGTAAGGAAAATAGG + Intergenic
980680469 4:136153338-136153360 CTATAAGAAATCAGGAAAATAGG - Intergenic
981696407 4:147563600-147563622 CAGTAAGAAGGGAAGAAAATTGG - Intergenic
983399953 4:167250187-167250209 GATTAAGAAGTGAGAGAAATGGG - Intergenic
983565324 4:169144502-169144524 CAGTACTAAATGAGGGAAATAGG + Intronic
986404285 5:7410182-7410204 CAGCAGGAAGTGATGGAAATTGG + Intronic
987098147 5:14567924-14567946 CTGTAAGAAGACATGGAACTAGG + Intergenic
988088140 5:26498149-26498171 TTGCAAGAAGTGACGGAAAAGGG - Intergenic
988478814 5:31612127-31612149 CTGTCAGATGTGGGGGAAACCGG + Intergenic
990491782 5:56309916-56309938 CTGTAGGAAATAAGGAAAATAGG + Intergenic
990515121 5:56523903-56523925 CTGTAAGAAGGCAGAGAAAGAGG - Intronic
990620309 5:57551808-57551830 CTGTAAAATATGTGGGAAATTGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992954503 5:81893442-81893464 ATGTAAAAACTAAGGGAAATGGG - Intergenic
993215797 5:85021412-85021434 CTGTTACAAATGGGGGAAATTGG + Intergenic
993248127 5:85478416-85478438 ATGACAGAAGTGAGAGAAATAGG + Intergenic
993308606 5:86299803-86299825 CTGTCAGAAGTGAGGGATGGGGG - Intergenic
993801696 5:92350838-92350860 CTATAAGAAGATAGGAAAATGGG + Intergenic
994346872 5:98697589-98697611 CTGTCAGAAGCCATGGAAATGGG + Intergenic
994671325 5:102765015-102765037 TTGAAGGAAGTGATGGAAATAGG - Intronic
995245367 5:109929336-109929358 TTCTAAGAAGTGAGAAAAATAGG + Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996593436 5:125174729-125174751 ATGTAAGCAGTGAGGGACATAGG - Intergenic
998378189 5:141705256-141705278 CTGAAAGAAGTGAGGGAGTGAGG - Intergenic
998702810 5:144723676-144723698 TGGTGAGAAGAGAGGGAAATGGG - Intergenic
998786711 5:145718869-145718891 GTGTAAGATGTGAGGGTAACAGG + Intronic
998886585 5:146700998-146701020 CTTTAAAAAGTGAAGAAAATGGG + Intronic
999312184 5:150558596-150558618 GTCTAAAAGGTGAGGGAAATGGG - Intergenic
1000002215 5:157149802-157149824 CTGTAAGAAGTAAAGGAAAGAGG - Intronic
1000184446 5:158845425-158845447 CTGTAAGATGGGAGGAACATCGG + Intronic
1001277142 5:170359218-170359240 CTGTAAGAAGGGAGAGCCATGGG - Intronic
1001741205 5:174054269-174054291 CTGTTAAATGTTAGGGAAATGGG + Intronic
1004121487 6:12826988-12827010 TTGCAACAAGTGAGGGAAAGTGG - Intronic
1004280343 6:14275067-14275089 AGGGAAGAAGGGAGGGAAATGGG + Intergenic
1006628836 6:35416801-35416823 CAGTAAGAAGTGCAGGATATTGG - Intronic
1007477771 6:42130392-42130414 CTCTCGGAAGTGAGGGAATTGGG - Intronic
1007495045 6:42254072-42254094 TTGTGAAAAGTGAAGGAAATAGG - Intronic
1007772196 6:44201031-44201053 CTGTAAGACATGAGCAAAATGGG - Intergenic
1008026160 6:46638387-46638409 CTGTGAGAAATTAGGGAATTTGG - Intronic
1009213248 6:60888356-60888378 CTGTAAGTAGACAGAGAAATGGG + Intergenic
1009473218 6:64054735-64054757 ATTTAAGAAGTGAGGAAACTGGG - Intronic
1010161257 6:72859555-72859577 CTGGAATAAGTGAGGGAAGCAGG - Intronic
1010532987 6:76990337-76990359 CTGAAAGAAAGAAGGGAAATGGG + Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1011587617 6:88943734-88943756 CTGAAAGAGCTGATGGAAATAGG - Intronic
1012448151 6:99327814-99327836 CTGTCAGGAGTGAGGGAGAGGGG - Intronic
1012503499 6:99917078-99917100 ATGTAAGAACTGAGAAAAATGGG - Intergenic
1012836793 6:104279765-104279787 ATGTGAGATGTGAGGGAAAAAGG - Intergenic
1013402497 6:109812499-109812521 ATGTAAGCAAAGAGGGAAATAGG + Intronic
1014827060 6:126058575-126058597 GTGTAAGAACTGAAGGAGATAGG + Intergenic
1015125492 6:129749813-129749835 CTGTAAAATGTGAGGGGGATCGG - Intergenic
1015486960 6:133782789-133782811 CTGTAACAAGTCAAGGAATTTGG + Intergenic
1015947769 6:138520868-138520890 CTGTTAGAAATGAGACAAATGGG + Intronic
1016555954 6:145338559-145338581 CTGGAAAAATTGAGGCAAATGGG + Intergenic
1017444835 6:154498237-154498259 CTGTAAGATGTGAATAAAATTGG - Intronic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1020610341 7:10388483-10388505 CTGTTAGAATTCAGGGCAATGGG + Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022759165 7:33328250-33328272 CAGTAAGAAGAGAGTGCAATGGG - Intronic
1023574565 7:41612510-41612532 CTGTAAAAAGTGAATGAAAACGG + Intergenic
1023864269 7:44231483-44231505 CTTTAACAAGAGAGGAAAATGGG + Intronic
1024839148 7:53564189-53564211 CTGTGAGAAGTGAAATAAATTGG - Intergenic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029923376 7:104290037-104290059 GTGTAAGAAGAGATGGAAAAGGG - Intergenic
1031673823 7:124585243-124585265 CTCAAAGAAATGAGAGAAATAGG - Intergenic
1031805584 7:126303009-126303031 CTGTAAAAAGGAAGGAAAATGGG + Intergenic
1032059517 7:128712852-128712874 CTTTAAGCAGTGAAGAAAATAGG - Intronic
1033473106 7:141666426-141666448 CTGAAAAAATTGAGGGGAATAGG + Intronic
1033584461 7:142763749-142763771 CTGTATGAAGAGAGAGAAAGAGG - Intronic
1033722747 7:144078868-144078890 CTGTTAGAAGTTAGGGTAATAGG - Intergenic
1033838954 7:145350391-145350413 CTGTAAGATGAGAGAGAAAATGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035862443 8:3044548-3044570 ATGAAAGAAGTGAGGGCTATTGG - Intronic
1036496624 8:9276053-9276075 AGGTAGGAAGTGAGGGAAAAAGG - Intergenic
1036718819 8:11153295-11153317 CTGTTAGAAGTGAGGAAATATGG + Intronic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1039471403 8:37815624-37815646 CTGTGAGTTGTTAGGGAAATGGG + Intronic
1039826164 8:41175686-41175708 CTGTCAGAAGTGAGGGGCACGGG + Intergenic
1040879949 8:52193547-52193569 CTGTCAGATGTGAGGGAAGCGGG - Intronic
1041178716 8:55225900-55225922 CTGTAAGAAGTGAAGAGTATAGG + Intronic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1043214515 8:77569296-77569318 CTGTTAAAAATGAGAGAAATTGG + Intergenic
1043256955 8:78149549-78149571 CTGTAAGAGGTAAGGCAAATGGG + Intergenic
1043993401 8:86783324-86783346 CTATAGGAGGTGAAGGAAATGGG + Intergenic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045806067 8:106163395-106163417 ATTTAAGAATTGAGGGAAGTTGG - Intergenic
1046549344 8:115693999-115694021 TCGTAAGAAATCAGGGAAATGGG + Intronic
1046592508 8:116223180-116223202 CTGTATGAAGTTAAGGAAACAGG - Intergenic
1046811948 8:118542968-118542990 ATGGAAGAAGTGAAGGAAAGAGG + Intronic
1047197987 8:122738888-122738910 CTGTCTGAAGGGAGAGAAATTGG - Intergenic
1049402682 8:142436693-142436715 CTGTAAAAAATGGGGGAAACTGG - Intergenic
1050193362 9:3053690-3053712 ATGTAAGAATTGTGGGCAATGGG - Intergenic
1051652175 9:19338859-19338881 GTGTAATAAGTGATGGAAAATGG + Intronic
1052120814 9:24714247-24714269 CTGTTACAAATGAGAGAAATAGG + Intergenic
1053108507 9:35435960-35435982 GTGGAAGAAGTTAGAGAAATAGG - Intergenic
1054743688 9:68833511-68833533 CTGTCAGAACTGAGGGGAGTAGG + Intronic
1055376810 9:75657549-75657571 CTGTAAACAGTGAGGGAATCAGG - Intergenic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1056002825 9:82235230-82235252 CTTTAAGATGTGAGGATAATAGG + Intergenic
1056984009 9:91344318-91344340 CTGGAAGCAGTGAGGGATAGGGG - Intronic
1057146212 9:92761011-92761033 CTGCAGGAAGTGGGGGCAATAGG - Intronic
1058673543 9:107380842-107380864 CAGAAAGCAGTGAGAGAAATGGG - Intergenic
1059031138 9:110697565-110697587 CTGGAACAACTGAGGGAAGTGGG - Intronic
1059585170 9:115598058-115598080 CTGTTATTAGTGAGGGAAAGAGG - Intergenic
1060150275 9:121284039-121284061 CTGAAAGAAGTGAGGGAGGCTGG + Intronic
1060346552 9:122821983-122822005 CTGCAAGATGGGAGGAAAATTGG - Intronic
1060614719 9:125002393-125002415 CTGAAAGAACTGTGAGAAATAGG - Intronic
1060636738 9:125205197-125205219 CTGTAAGGAGCCAGGGAGATAGG - Intronic
1186460257 X:9742782-9742804 GTGTCAGGAGTGAGGCAAATGGG + Intronic
1187236668 X:17474511-17474533 CTGCAAGGAGTGAGGGAAGCAGG + Intronic
1188362625 X:29274478-29274500 CTGTAAGAAGTTAATCAAATAGG + Intronic
1188524038 X:31070913-31070935 GGGGAAGAAGTGAAGGAAATGGG - Intergenic
1188606113 X:32032500-32032522 TTGTAAGAAGTAACAGAAATGGG + Intronic
1188972629 X:36636332-36636354 CTGTAAGGAGTGAAGGAAGCAGG - Intergenic
1189517189 X:41725613-41725635 CTGAAAGAAGTGAGGAAATAAGG + Intronic
1190061900 X:47217135-47217157 CTGGAAGAAGTGAGAGAATGAGG + Intergenic
1190169829 X:48103271-48103293 CAGAAAGAAGTGAGGAACATGGG + Intergenic
1190891979 X:54577568-54577590 CTGGAGGTGGTGAGGGAAATGGG - Intergenic
1191119880 X:56892157-56892179 CTGAAAGTAATGGGGGAAATGGG + Intergenic
1193295799 X:79829971-79829993 CTGTAAGGAGTAATGGAATTAGG + Intergenic
1193939954 X:87670227-87670249 ATGTAAACAATGAGGGAAATGGG + Intergenic
1194328831 X:92556425-92556447 CTGTTCCAAGTGAGAGAAATTGG + Intronic
1194359860 X:92936823-92936845 CTGAAAGAAGTGTGGAAAAATGG - Intergenic
1194467138 X:94246687-94246709 CTATTCGAAGTGAGAGAAATTGG - Intergenic
1196799783 X:119532266-119532288 GTGTGAGAAGTGAGGGGAAGAGG - Intergenic
1197077104 X:122365122-122365144 CTGTAAGATGCCATGGAAATAGG + Intergenic
1197430747 X:126360188-126360210 ATTTATGAAATGAGGGAAATGGG - Intergenic
1197891193 X:131272474-131272496 CTGTAAGGATTAAGGTAAATGGG + Intergenic
1200668057 Y:6052643-6052665 CTGAAAGAAGTGTGGAAAAATGG - Intergenic
1201011513 Y:9551479-9551501 CTTACAGAAGTGAGGGAAAAGGG + Intergenic
1201332416 Y:12838987-12839009 CTGTCAGAAGTGTGGGTAACAGG - Intronic