ID: 1045412729

View in Genome Browser
Species Human (GRCh38)
Location 8:101934895-101934917
Sequence TTGCCTAAGTCTGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045412729_1045412738 29 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412738 8:101934947-101934969 AACAGTGGGGTAAGCTGGCTGGG No data
1045412729_1045412737 28 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412737 8:101934946-101934968 GAACAGTGGGGTAAGCTGGCTGG No data
1045412729_1045412733 15 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412733 8:101934933-101934955 AAATATCACCAAAGAACAGTGGG No data
1045412729_1045412734 16 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412734 8:101934934-101934956 AATATCACCAAAGAACAGTGGGG No data
1045412729_1045412732 14 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412732 8:101934932-101934954 AAAATATCACCAAAGAACAGTGG No data
1045412729_1045412736 24 Left 1045412729 8:101934895-101934917 CCATCCTCCTCAGACTTAGGCAA 0: 1
1: 0
2: 2
3: 34
4: 272
Right 1045412736 8:101934942-101934964 CAAAGAACAGTGGGGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045412729 Original CRISPR TTGCCTAAGTCTGAGGAGGA TGG (reversed) Intronic
903150738 1:21406229-21406251 TTGCCTAGGGCTGAGGGGGTGGG - Intergenic
904771508 1:32883889-32883911 GTGCCTCAGTCTGAGGTGGGAGG + Intergenic
905231127 1:36515477-36515499 TGGCCTGAGTCTGGGGACGAAGG + Intergenic
906531880 1:46528413-46528435 ATGCCTAACTCTGGGCAGGAAGG - Intergenic
906743796 1:48207619-48207641 GTGAGTAGGTCTGAGGAGGATGG - Intergenic
906957242 1:50384793-50384815 TTGCCAGAGACTGGGGAGGAGGG - Intergenic
907501210 1:54882819-54882841 TTGCCTAAGGCTGTGGGGGGCGG + Intronic
907729325 1:57050467-57050489 ATGACTAAGTCTGAGGTGGCAGG - Intronic
909267539 1:73579794-73579816 TTCCAAAAATCTGAGGAGGAGGG + Intergenic
910575921 1:88763639-88763661 TTCTTTAAGTCTGAGGAGGATGG - Intronic
911024850 1:93426025-93426047 TTGCCTATGGCTGAGGAGAATGG + Intergenic
911177736 1:94833705-94833727 TTTCCTAAGTCAGATGAGAAGGG - Intronic
911238630 1:95439877-95439899 CTGCCTAGGTCTGAGGAAGATGG - Intergenic
912689114 1:111790736-111790758 TTGCCTAAGTCTGAGAGGTGGGG - Intronic
912991440 1:114490987-114491009 CTGCCTAAGTCTGGGGGGAATGG + Intronic
913175369 1:116268217-116268239 CTGGCCAAGGCTGAGGAGGAGGG - Intergenic
913178956 1:116300931-116300953 TTGCCTAGGGCTGAGGAGGTTGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
915078534 1:153333527-153333549 TTCCCAAAAACTGAGGAGGAGGG + Intronic
917118499 1:171625599-171625621 TTGCCCAGCCCTGAGGAGGATGG + Intergenic
919166555 1:193902377-193902399 CTGCCTAGGACTGAGTAGGATGG + Intergenic
920784845 1:209031313-209031335 TTACCTATGTCTGAAGAAGAGGG + Intergenic
921521064 1:216154652-216154674 TTGCCTAGGCCTGAGGAGGAGGG - Intronic
922263946 1:223966780-223966802 TTGCCTAAGGCTGGGGGCGAAGG + Intergenic
923374603 1:233348152-233348174 TTGCCTAGGGCTGAGAGGGAAGG - Intronic
923454994 1:234156943-234156965 TTGCCTAGGGTTGAGGAGGGTGG + Intronic
923895708 1:238267541-238267563 TTCCAAAACTCTGAGGAGGAGGG + Intergenic
923903812 1:238360010-238360032 TTGCCTAAGGCTGGGAGGGATGG - Intergenic
924345793 1:243071776-243071798 TTGCCTAAGGCTGGGGGCGAAGG + Intergenic
924639728 1:245822594-245822616 CTGCCTCAGTCTGAGGAGCTCGG + Intronic
1063686262 10:8239811-8239833 TGGCCTAGAACTGAGGAGGAAGG + Intergenic
1064130739 10:12707515-12707537 TGGCCAAAGCCTGCGGAGGAAGG + Intronic
1064950637 10:20845803-20845825 TTGCAAAAGTCTGATGAAGAAGG - Intronic
1066468088 10:35670798-35670820 TTGGCTCAGTCTTAGGAGAATGG + Intergenic
1067411379 10:46067670-46067692 TTGCCTAGGGCTGGGGAGGATGG + Intergenic
1067936554 10:50617400-50617422 TTGCTTAAGTCTGGGGACAAAGG + Intronic
1068121947 10:52789776-52789798 TTGCCAAGGGCTGAGGAGGAGGG - Intergenic
1068774677 10:60857052-60857074 TTCCCTAATTCTAAGGAGGCTGG - Intergenic
1070169620 10:73922903-73922925 TTGCCTAGGGCTGAGGGGGTTGG - Intergenic
1071039578 10:81290288-81290310 TTCCATAAAACTGAGGAGGAGGG + Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1072510994 10:96124652-96124674 TTGCTTCAGCCTGAGGGGGAGGG + Intergenic
1073257871 10:102166288-102166310 TTGCCAAGGGCTGGGGAGGAGGG - Intergenic
1073975964 10:109101732-109101754 TTGCCTAAATCTTAGGAAGGAGG - Intergenic
1074057081 10:109932254-109932276 TTGCCTGTGACTGGGGAGGATGG - Intergenic
1074165068 10:110867799-110867821 CTGCTTAAGCCTGAGGAGTACGG + Intergenic
1074183230 10:111080611-111080633 CTGCCAAAGTCAGGGGAGGAGGG + Exonic
1074548445 10:114420566-114420588 TTGCTTAAGGCTGAGGGGGATGG - Intergenic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075235159 10:120721313-120721335 TTGCCTAAGTCATATGGGGAAGG - Intergenic
1075827464 10:125371280-125371302 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
1077381799 11:2246816-2246838 TTACCTAAGGCTGGGGAGGAGGG + Intergenic
1077447359 11:2603540-2603562 TTGCCTAGGGCTGAGGGGGATGG - Intronic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1078102322 11:8337221-8337243 TTTCCCCAGTCTGAAGAGGACGG - Intergenic
1078918786 11:15807248-15807270 TTGCCTGTGGCTGTGGAGGAGGG - Intergenic
1079097724 11:17521677-17521699 TTACCTAAGTGTTTGGAGGAGGG - Intronic
1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG + Intronic
1079333469 11:19552011-19552033 TTCCCTTTGTCTGAGGAGGACGG + Intronic
1081115974 11:39201388-39201410 TTGCTCCAGTTTGAGGAGGATGG - Intergenic
1081250572 11:40826975-40826997 TTACGTAAGTCTTAGGAGAACGG - Intronic
1081431362 11:42979858-42979880 TTGCCAAAGTGAGATGAGGAGGG + Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1084433550 11:69124633-69124655 GAGGCTAAGTCAGAGGAGGAGGG + Intergenic
1084519015 11:69651439-69651461 TTGCTTAAGTCAGAGATGGAAGG - Exonic
1085794506 11:79525670-79525692 CTGCCAAAGGCTGAGGGGGAGGG - Intergenic
1086342588 11:85861642-85861664 TTTCCTAATTCTGTGGAGGCTGG - Intronic
1086735046 11:90295837-90295859 TTGCCAGAGGCTGAGGATGAAGG + Intergenic
1087214438 11:95480202-95480224 CTGCCTAAGCCTTAGGAGAAGGG - Intergenic
1088113466 11:106289008-106289030 ATGCCTAAGTGTGGGGAGAAGGG - Intergenic
1088348677 11:108860450-108860472 TTGACTAAGTGTTAGGAGTATGG - Intronic
1091697641 12:2638760-2638782 TGGCCTAAATCAGAGGAGGATGG + Intronic
1091895670 12:4102088-4102110 TTGCCAAAGGTTGAGGGGGATGG + Intergenic
1092213773 12:6666119-6666141 CTGCCTGAGTCTGTGGAAGAGGG - Intergenic
1092658790 12:10716701-10716723 TCCCCTAACTCTGAGTAGGAGGG + Intronic
1092808292 12:12248137-12248159 TTGCTTTAGCCTTAGGAGGAAGG - Intronic
1093239756 12:16655829-16655851 TTCCATAAATTTGAGGAGGAGGG - Intergenic
1093449380 12:19297884-19297906 TTATCAAATTCTGAGGAGGAGGG + Intronic
1094133682 12:27101577-27101599 TGGCCTAAGCCATAGGAGGATGG - Intergenic
1094183821 12:27619621-27619643 TGGCCTAAGCCATAGGAGGATGG - Intronic
1096561845 12:52441160-52441182 TTGCCTCATTCTGAGGTGCATGG + Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1097232994 12:57523252-57523274 TTCCCTCAGCTTGAGGAGGAGGG - Intronic
1097836009 12:64273408-64273430 ATGCATAAGTTTGAGGAGGTGGG + Intronic
1100512288 12:95287426-95287448 GTGCCTAAGGCTGAGGTGGGAGG - Intronic
1100717560 12:97321998-97322020 TTGCCTTAGTATTATGAGGAAGG - Intergenic
1100797827 12:98201205-98201227 ATGCCTAACTGTGAGGAGGCTGG - Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102742026 12:115216478-115216500 TTGCCTGAGGGTCAGGAGGAAGG + Intergenic
1102778928 12:115546709-115546731 GTGCCTCTGTTTGAGGAGGAGGG + Intergenic
1103040516 12:117691417-117691439 TTGCCTAAGTGGGAGGGAGAAGG - Intronic
1103314061 12:120037838-120037860 TTGCCTACTTCTGAGAAGGATGG - Intronic
1105425965 13:20295522-20295544 GTGCCTAATTCTGAGTGGGAAGG + Intergenic
1106567583 13:30899744-30899766 TTGCTTAAGGCTGTGGAAGATGG - Intergenic
1107514311 13:41114280-41114302 TTGCCTCAGTCTGAGGGAGGGGG + Intergenic
1109437984 13:62331736-62331758 TTGCCCAAATGTGAGGAGGAAGG - Intergenic
1109940489 13:69357784-69357806 TGGCCTAAGATTGAGAAGGAAGG + Intergenic
1110130370 13:72001572-72001594 TTGGCTAAACCTGACGAGGAAGG - Intergenic
1110202151 13:72864228-72864250 TTGCTTGAGAGTGAGGAGGATGG + Intronic
1110295604 13:73860633-73860655 ATGCCAAAGACTGAGGAAGAAGG + Intronic
1110544007 13:76736551-76736573 TTGCCCAAGCCTGAGAATGAGGG - Intergenic
1110945810 13:81414486-81414508 TTGCCAAGGTCTTAGGAGGAGGG + Intergenic
1111571507 13:90093248-90093270 TTGCCAGGGTCTGGGGAGGAGGG + Intergenic
1115478656 14:33840577-33840599 TGGCCTTTGTCTGATGAGGAGGG - Intergenic
1116071826 14:40056834-40056856 TTGTCTAAGGCTGAGGATAAAGG + Intergenic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1119144036 14:72294192-72294214 TTGCATAAGTGGGAGGAAGAGGG + Intronic
1120660048 14:87239071-87239093 CTACCTCAGCCTGAGGAGGAGGG + Intergenic
1120674136 14:87400504-87400526 TTGGCAAACTCTGAGGAGAAAGG + Intergenic
1121354674 14:93204420-93204442 TTGCCGAAGGCTGAGGGGAATGG - Intronic
1121632680 14:95432485-95432507 GTCCCTAAGTCTGAGGAGGGTGG - Intronic
1122485157 14:102074419-102074441 TTGCCCAAGCTTGGGGAGGAGGG - Intergenic
1127921000 15:63493962-63493984 TGGCCTAATTCTGAGGCGCAAGG + Intergenic
1128424869 15:67531737-67531759 TTGCCTAGGGCTGAAGAGGTTGG + Intergenic
1130365558 15:83235028-83235050 TTCCATAAGTCTAGGGAGGATGG - Intergenic
1130688125 15:86057011-86057033 TGGCCTTAGTCTGAGGGAGAAGG - Intergenic
1131094861 15:89648694-89648716 TCGTCGAAGTCGGAGGAGGAAGG + Exonic
1131352312 15:91712600-91712622 TTGCCTAAGTCTCAGTCAGAGGG - Intergenic
1131460979 15:92617350-92617372 GGGCCCAAGGCTGAGGAGGAGGG - Intergenic
1131515486 15:93073669-93073691 TTGTCTAGGTCTGGGCAGGATGG + Intronic
1133102215 16:3486391-3486413 CTGCCCCAGCCTGAGGAGGAGGG + Exonic
1134017822 16:10901631-10901653 TGGCCCAAGTCTGATGGGGATGG + Intronic
1134602672 16:15545746-15545768 TTGGCTGAGTCTGAGGAAGTGGG + Intronic
1134691283 16:16192335-16192357 TTGGCTCAGTCTGAGGAAAATGG + Intronic
1137776929 16:51063142-51063164 TTGTCTAAGTCTGGGGAGAGAGG - Intergenic
1141176994 16:81727400-81727422 TTGCTTAGGGCTGAGGGGGATGG + Intergenic
1142105410 16:88299804-88299826 TTGCCTGACCCTGAGCAGGATGG + Intergenic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1147552530 17:41454229-41454251 TTGCCAAAGCTTGAGGAGCAGGG + Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1148220215 17:45855997-45856019 TTGCCAGAGGCTGGGGAGGAAGG - Intergenic
1150381248 17:64721774-64721796 TTGCCTAGGGCTGGGGAGGAAGG + Intergenic
1150775253 17:68076329-68076351 TTGCCTAGGGCTGGGGAGGAAGG - Intergenic
1150807891 17:68333733-68333755 GTGCTTCAGTCTCAGGAGGAAGG + Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152024545 17:77800272-77800294 TTGCCTAGGGCTGCGGAGGTGGG + Intergenic
1153013745 18:564943-564965 TTGTGTACGTGTGAGGAGGAGGG + Intergenic
1155876983 18:31101150-31101172 TTCCCTAAATCTTCGGAGGAAGG - Intronic
1157550497 18:48577985-48578007 TTGCCTAGGGCTGAGGAAGCTGG - Intronic
1159898411 18:74019337-74019359 CTGCCTCAGTCTGTGCAGGAGGG + Intergenic
1162184960 19:8897655-8897677 TTCCCCAGGTCTGAGAAGGATGG - Exonic
1162186538 19:8909467-8909489 TTCCCCAGGTCTGAGAAGGATGG - Exonic
1163153848 19:15429600-15429622 TGGCCTCAGTCTGAGGATGAGGG - Intronic
1164635654 19:29789372-29789394 TTGCCTAGGGCAGAGGAGGTGGG + Intergenic
1165133498 19:33648393-33648415 TTGCCTAGGACTGGGCAGGAAGG - Intronic
1166611483 19:44203039-44203061 TTGCCTAGGGCTGAGGAGTTTGG + Intergenic
1166908973 19:46137504-46137526 TTGCCTGAGCCAGAGGATGAAGG + Intergenic
1167109803 19:47453375-47453397 CTGCCTCAGTCTGAGCAGGCAGG - Intronic
925894974 2:8464071-8464093 CGGCCTATGTCTGAGTAGGAGGG - Intergenic
926819682 2:16838859-16838881 CTGCCAAAGTCTGAGGATAAGGG + Intergenic
926988966 2:18656210-18656232 CTGGCTCTGTCTGAGGAGGATGG + Intergenic
927296070 2:21454433-21454455 TTGGTTAAGTCTGAGGTGGGAGG + Intergenic
928698397 2:33873473-33873495 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
930889899 2:56372599-56372621 ATGTCTAAGTCTGGGGAGGGAGG + Intronic
931645741 2:64420116-64420138 TAGCCTAAGTTAGAAGAGGATGG + Intergenic
932531354 2:72537126-72537148 TTTCCAAAGTCTTAGGATGAGGG - Intronic
932771349 2:74502479-74502501 TTTCCTAAGGGTGGGGAGGAGGG - Intronic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
934733479 2:96674179-96674201 TTGCCTAGGGCTGGGGAGGTGGG - Intergenic
935596434 2:104881838-104881860 TTGCCCATGTCTGAGGCCGAGGG - Intergenic
935601045 2:104921584-104921606 TTGCTTCAGTCAGAGGAGAAGGG - Intergenic
935718633 2:105960439-105960461 GTGACTTAGTCTAAGGAGGATGG - Intergenic
936006763 2:108896046-108896068 CTGCCTAAGACTGAAGTGGAAGG + Exonic
940403985 2:153279901-153279923 TTGCAAAAGTTTGAGCAGGAAGG - Intergenic
946382253 2:219357007-219357029 TTGCCTAGGGCTGAGGAGGGTGG + Intergenic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
947250174 2:228093919-228093941 TTGCCTAGGCCTAAGGAGGATGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169943652 20:10965296-10965318 TTGCCTATGACAGAGAAGGATGG + Intergenic
1170579928 20:17691062-17691084 TTTCCTAAATGTGAGCAGGATGG - Intergenic
1171564746 20:26171160-26171182 CTGCCTAATTCGGAGCAGGAGGG + Intergenic
1172128639 20:32640806-32640828 TTGCCTAGGTCTGGAGAGGGGGG - Intergenic
1173937615 20:46880939-46880961 TTGCCTGAGAGTGAGGAGGTGGG + Intergenic
1174441642 20:50560315-50560337 CTGCAGAAGTCTGAGGAGCATGG + Intronic
1174783470 20:53411539-53411561 GTACCTAAGGCTGAGGATGATGG + Intronic
1175091693 20:56510076-56510098 TTGCCTAAGACTGAGGAAAGGGG + Intronic
1179594268 21:42431399-42431421 CTGCCTGAGGCTGGGGAGGAAGG + Intronic
1179989680 21:44940586-44940608 TTGCTTAGGGCTGAGGGGGATGG - Intronic
1181435539 22:22908302-22908324 GTGCCCAAGACTGATGAGGAGGG - Intergenic
1182916904 22:34042015-34042037 TTGCCTAGGGCTGAGGGAGAAGG - Intergenic
1185030050 22:48437832-48437854 TTGCCTGACCCTGTGGAGGACGG - Intergenic
949986158 3:9542904-9542926 TTGCTTAGGGCTGAGAAGGAAGG + Intronic
950011315 3:9726048-9726070 CAGCGTGAGTCTGAGGAGGAGGG + Exonic
950460418 3:13118638-13118660 TTGCCAAAGGCTGGGGAGGAGGG + Intergenic
950888696 3:16383876-16383898 TTGTCTGACTCTAAGGAGGATGG + Intronic
951213390 3:20000090-20000112 TTTCCAAAGCCTGAGGAGGCTGG - Intronic
951655376 3:25001559-25001581 TGGCTTAATTCTGAGGAGGTGGG - Intergenic
953085390 3:39660665-39660687 TTGCCTAAGTCTGAGGAGTGTGG + Intergenic
954224034 3:49171515-49171537 TTCCCTGAGTCGGAGGGGGAGGG + Intergenic
956168936 3:66417637-66417659 TGGACTAGGTCTGAGGATGATGG - Intronic
956170773 3:66431783-66431805 TTGCCCAAGGCTGAGATGGAAGG - Intronic
958513595 3:95081976-95081998 TTGCCTAAGGCTGAGTGGGTAGG - Intergenic
959633873 3:108539313-108539335 GTACTTAAGTTTGAGGAGGAGGG + Intergenic
962217728 3:133537147-133537169 TTACATAAATCTGATGAGGAAGG - Intergenic
962701221 3:138001293-138001315 TTGCCTAAGTCTGATGCTGCAGG + Intronic
962834894 3:139181284-139181306 TAGCCTGAGTCTGTGGAGGATGG + Intronic
964580648 3:158232677-158232699 TAGCCTATGTCTGGGGAGCACGG + Intronic
968007022 3:195250015-195250037 TTGACTGGGTCAGAGGAGGAGGG - Intronic
968154935 3:196372783-196372805 TTGCCTAAGTCGGAGAACAATGG + Intronic
968226406 3:196975071-196975093 TTGACTCCGGCTGAGGAGGAAGG + Intergenic
968259266 3:197306599-197306621 TTGCCTAGGGTTGAGGAGCATGG + Intergenic
969104847 4:4797946-4797968 TTCCCTAATTCTTTGGAGGAGGG - Intergenic
969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG + Intronic
971267636 4:25109102-25109124 CTGGCTCAGTCTCAGGAGGAGGG - Intergenic
971433249 4:26591066-26591088 TTGCCGGAGTCTCAGGGGGAAGG - Intronic
971456074 4:26845535-26845557 TTGCCAAGGTCAGGGGAGGAGGG - Intergenic
971708239 4:30076567-30076589 TTCCATAAAACTGAGGAGGAGGG - Intergenic
971808042 4:31385876-31385898 TTGCCTAAGTGTTCAGAGGAAGG + Intergenic
972035969 4:34521340-34521362 TTGCCTAGGGCAGAGAAGGATGG - Intergenic
972699716 4:41482410-41482432 GTCCCTAAGGCTGTGGAGGAAGG + Intronic
975370588 4:73581715-73581737 TTGCCTCATTCTGTGGAGAAAGG - Intronic
975987335 4:80213464-80213486 AGGCCTGAGTCTGAGGAGGTGGG + Intergenic
976210494 4:82663787-82663809 TTGCCTATGTCTGGGGGTGAGGG - Intronic
976713576 4:88099846-88099868 TTCCCTATTTCTGATGAGGAAGG + Intronic
977922088 4:102656902-102656924 GTGCCTAAAACTGGGGAGGAGGG + Intronic
979331428 4:119424639-119424661 TTGCCTAAGGCTGGGGGCGAAGG + Intergenic
979459370 4:120963474-120963496 TTGGCTAAGTCTCAGGGTGAGGG + Intergenic
980778626 4:137467911-137467933 TTGCCAAAGTTTGAGGGGAATGG + Intergenic
981075849 4:140590930-140590952 TTGTCTATGTCTTAGGAGAAAGG + Intergenic
982062507 4:151618593-151618615 TCGCCAAAATCTGTGGAGGAAGG + Intronic
984446817 4:179848009-179848031 TTGCCTAAGGCTGGAGTGGATGG + Intergenic
985165454 4:187089602-187089624 TTGCCTAAGTGTGGGAAGAAGGG + Intergenic
985479252 5:97459-97481 TTGCCTGGGGCTGGGGAGGACGG - Intergenic
985711061 5:1430245-1430267 GTGACGAACTCTGAGGAGGACGG - Intronic
985841972 5:2313317-2313339 TTGCCAGAGGCTCAGGAGGAGGG - Intergenic
986034843 5:3927626-3927648 TGGCTCAAGGCTGAGGAGGATGG - Intergenic
987656175 5:20809367-20809389 TTGCCTAAGACTGAGGGTGATGG - Intergenic
988670360 5:33374939-33374961 TTGCTAAAGTGTGAGGAGGTGGG + Intergenic
988767377 5:34394573-34394595 TTGCCTAAGACTGAGGGTGATGG + Intergenic
989308648 5:39987302-39987324 TTGCCCCAGTCTGAAAAGGAAGG - Intergenic
989419811 5:41224412-41224434 GTGCCTAAGACTGGGGAGGAGGG - Intronic
989812005 5:45688966-45688988 TTGCTTAAGGCTGAGCGGGAGGG + Intronic
991132058 5:63133745-63133767 TTGCCTCCTTCAGAGGAGGAGGG - Intergenic
991551955 5:67847005-67847027 TTGCCTAGGGCTGAGCAAGAGGG + Intergenic
993532660 5:89043267-89043289 TTGCATATGTTTGGGGAGGAGGG + Intergenic
995227171 5:109713619-109713641 TTGAGTGAGTCTGTGGAGGATGG + Exonic
996635642 5:125686072-125686094 TTGCTTCAATCTGAGGGGGAGGG - Intergenic
1001404929 5:171469515-171469537 TTGACTCAGCCTGGGGAGGAAGG - Intergenic
1004265612 6:14146051-14146073 TTCCCCCAGTGTGAGGAGGAGGG - Intergenic
1005730986 6:28696589-28696611 TTCCCTAAGTCTGGGTGGGAGGG - Intergenic
1005881176 6:30061973-30061995 ATGCCTATGTCGGTGGAGGAAGG + Exonic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007739461 6:44002101-44002123 TTTCCTATGTCTGGGGTGGAGGG - Exonic
1008158567 6:48048552-48048574 TCCCCTAAGGCTGTGGAGGATGG + Intronic
1008907280 6:56693271-56693293 TGGCCTCAGACTGAAGAGGATGG - Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1012403435 6:98865317-98865339 TTGCTAAAGTCTGAGAATGAAGG - Intergenic
1013251057 6:108333782-108333804 GTGGCTAATACTGAGGAGGAAGG + Intronic
1017230022 6:152063859-152063881 TCGCCAAGGTCTGAGGAGGCTGG + Intronic
1018181827 6:161229820-161229842 TTGCCTATGTCCCCGGAGGAAGG - Intronic
1018347577 6:162918004-162918026 TTGTCTATGTCTGAAGAGGTTGG - Intronic
1020393724 7:7689012-7689034 CTGCCTTACTCTGGGGAGGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023252067 7:38275153-38275175 CTGCATAGGTCTGATGAGGAAGG + Intergenic
1023319292 7:38976042-38976064 CTGCCTAAGTCCGAGGACGCAGG + Intergenic
1024071849 7:45792980-45793002 TTGCCTAAGGCTGGGGGCGAAGG - Intergenic
1024276236 7:47679266-47679288 TTGTCTAATTCTGACGAGGCAGG + Intergenic
1026136093 7:67662334-67662356 CAGCCAAAGTCTGAGGATGAGGG - Intergenic
1026564610 7:71479703-71479725 TTTCTTATGTCTGAGGAGGAAGG - Intronic
1030147204 7:106368766-106368788 TTCCCCAATTCTGAGGAAGATGG - Intergenic
1030155395 7:106449417-106449439 TTGCCAAAGACTGAAGTGGAAGG + Intergenic
1030186786 7:106770466-106770488 TTGCCTGTGTGTCAGGAGGAAGG + Intergenic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1031004154 7:116453244-116453266 TTGGAAAGGTCTGAGGAGGAAGG - Intronic
1032049234 7:128636692-128636714 TTGCCTAAGGCTGGGGGCGAAGG - Intergenic
1032417512 7:131748028-131748050 CTGCATATGTCAGAGGAGGAAGG + Intergenic
1032773849 7:135090038-135090060 TGGCCTGACTCTGGGGAGGAAGG + Intronic
1033358683 7:140622504-140622526 TTTAACAAGTCTGAGGAGGAGGG - Intronic
1033420392 7:141200136-141200158 TTGCCAAAGTCTTAGGATGGTGG + Intronic
1033437479 7:141346567-141346589 TTGCCTATGTGTGAGGTGGCTGG - Intronic
1033621284 7:143063916-143063938 TTGGCTGGGTCTGAGGATGAAGG + Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034511362 7:151537557-151537579 TTGCCTAATTTGGAGGGGGATGG + Intergenic
1037883784 8:22585827-22585849 TGGGCTGAGTCAGAGGAGGAAGG - Intronic
1038582052 8:28756260-28756282 TTGGCTATGTCTGAGGATGGAGG - Intergenic
1038699595 8:29837176-29837198 GAGTCTAAGTATGAGGAGGAAGG + Intergenic
1040279214 8:46029557-46029579 ATGCCTAAGTCACAGCAGGATGG + Intergenic
1041079337 8:54201849-54201871 TGGCCTGAGTTTGGGGAGGAAGG + Intergenic
1043464281 8:80489035-80489057 TTGCCTAAGCCCTAGAAGGAAGG + Intronic
1043645081 8:82507575-82507597 TTTCCTGAGTCTGATGATGAAGG + Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1047501285 8:125443777-125443799 TGGCCTCAGTTTGAAGAGGAAGG + Intergenic
1047768271 8:128007970-128007992 TTACCTTTGTCTGAGGAGGCTGG + Intergenic
1047926579 8:129688472-129688494 TTGCCTATTTGTTAGGAGGAGGG + Intergenic
1049402117 8:142433036-142433058 TTGGGGAAGTCAGAGGAGGAGGG + Intergenic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1055805815 9:80092055-80092077 TTGCCTAAGGCTGAAGAGATGGG + Intergenic
1056819762 9:89830790-89830812 TTGCCAGGGGCTGAGGAGGAGGG - Intergenic
1057268730 9:93635375-93635397 TTGCCTTTGTCTGTGAAGGAAGG + Intronic
1057578295 9:96261764-96261786 CTGCCCAAGTCTGAGGAGTAGGG - Intronic
1060295535 9:122340672-122340694 GTGCCTGAGTATGAGGAAGATGG + Intergenic
1061086648 9:128403334-128403356 TTGCCTAGGGCTGGGGAGAAGGG + Intergenic
1061425289 9:130494606-130494628 TTCCCTAAGGGTCAGGAGGAGGG - Intronic
1061452628 9:130676823-130676845 TAGGCTGAGTCTCAGGAGGATGG + Intronic
1188336070 X:28934546-28934568 TTGCCTATGGCTGAGGGGGAAGG - Intronic
1192405285 X:70879099-70879121 TTGCCTAGGGCTGAGGGTGAGGG + Intronic
1194163182 X:90481066-90481088 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1194219420 X:91172835-91172857 TTCCATAAAACTGAGGAGGAGGG - Intergenic
1195453744 X:105044527-105044549 AAGCCTAAGCCTGAAGAGGAGGG + Intronic
1195911479 X:109892341-109892363 TTGCCTAGGTTTAAGGAGGTGGG - Intergenic
1196764111 X:119227306-119227328 TTGACTAAGGCAGAGGAGGTAGG - Intergenic
1197759588 X:130018296-130018318 TTGCCTAGGGTTGGGGAGGATGG + Intronic
1198401088 X:136268999-136269021 AACCCTAAGTCTGAGCAGGAAGG + Intergenic
1199947524 X:152680626-152680648 TTTCCTAAGTCTGGGAAGAAAGG - Intergenic
1199962155 X:152787828-152787850 TTTCCTAAGTCTGGGAAGAAAGG + Intergenic
1200133863 X:153865245-153865267 TCGCCCAGGTCTGGGGAGGAGGG + Intronic
1200509456 Y:4058791-4058813 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1200555933 Y:4636597-4636619 TTCCATAAAACTGAGGAGGAGGG - Intergenic
1201950431 Y:19557883-19557905 TTGCCTCAGTATGTGGGGGAAGG + Intergenic