ID: 1045413170

View in Genome Browser
Species Human (GRCh38)
Location 8:101940355-101940377
Sequence TGTTATATATGTCCACATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045413170_1045413173 15 Left 1045413170 8:101940355-101940377 CCCTTATGTGGACATATATAACA 0: 1
1: 0
2: 0
3: 18
4: 267
Right 1045413173 8:101940393-101940415 TCCGTCAGAGGAAATGTGTATGG No data
1045413170_1045413172 3 Left 1045413170 8:101940355-101940377 CCCTTATGTGGACATATATAACA 0: 1
1: 0
2: 0
3: 18
4: 267
Right 1045413172 8:101940381-101940403 AGTAATTCATCATCCGTCAGAGG No data
1045413170_1045413175 27 Left 1045413170 8:101940355-101940377 CCCTTATGTGGACATATATAACA 0: 1
1: 0
2: 0
3: 18
4: 267
Right 1045413175 8:101940405-101940427 AATGTGTATGGAAGCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045413170 Original CRISPR TGTTATATATGTCCACATAA GGG (reversed) Intronic
900897235 1:5492220-5492242 TTTTATATATCTGCACATCAAGG - Intergenic
902146590 1:14406322-14406344 TGTGATATATATACACACAATGG + Intergenic
907379847 1:54077515-54077537 TGTCATTTATGTCAACAGAAAGG - Intronic
907605989 1:55817957-55817979 TTATATACATGTCCACATAAAGG + Intergenic
911185004 1:94894410-94894432 TGCTATATAAGTCCAGTTAATGG - Intronic
911355567 1:96814672-96814694 TGTTATCTATGTAGACAGAATGG + Exonic
914415889 1:147481494-147481516 TTATATATATTTCCATATAATGG + Intergenic
916359175 1:163948863-163948885 TGTTTTATTTGTGCACAGAAAGG + Intergenic
917395523 1:174589629-174589651 TTTTATATATGTCGAGAGAAAGG + Intronic
917722040 1:177794997-177795019 TATTATTTCTGTCCAAATAATGG + Intergenic
919289097 1:195605460-195605482 TGTTCTTTTTGTCAACATAATGG + Intergenic
919388341 1:196950332-196950354 TCTTCTATATGTACATATAAAGG + Intronic
919550046 1:198974683-198974705 TGTTAAAGAGGTACACATAAAGG + Intergenic
920920508 1:210293816-210293838 CGTTATATAAGTCCTCATAATGG - Intergenic
922009798 1:221571555-221571577 TATTATATTTGGCTACATAAAGG + Intergenic
922319403 1:224472419-224472441 TGGTATATATGTATACATCATGG + Intronic
922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG + Intergenic
923164358 1:231345517-231345539 TGTTTTATACATCCATATAATGG - Intronic
923844609 1:237715073-237715095 TCTTAAATATGCCCACATATGGG + Intronic
1063342282 10:5277499-5277521 TGGTGTACATGTCCATATAATGG + Intergenic
1067005886 10:42661584-42661606 TGTGTTATATGTCCACAGCAGGG - Intergenic
1068270012 10:54709934-54709956 TGTAATATATATATACATAAAGG - Intronic
1068325416 10:55479442-55479464 TGTTATAGATGTTATCATAAGGG - Intronic
1069372768 10:67765037-67765059 TCTTAGATACATCCACATAATGG + Intergenic
1070045926 10:72836420-72836442 TGTTATATATATCTATATATAGG + Intronic
1070423218 10:76258822-76258844 TGTGATATATATACACACAATGG - Intronic
1072467088 10:95674865-95674887 TGTTGTAAATGTCCATGTAAAGG + Intronic
1076024901 10:127103225-127103247 TGCTAGAGACGTCCACATAAGGG + Intronic
1076227250 10:128788909-128788931 TGTTGTATATGACTATATAAAGG - Intergenic
1078286996 11:9967037-9967059 TGTGATATATATCCAAACAACGG + Intronic
1079803890 11:24905104-24905126 TATTATATATATACATATAAAGG - Intronic
1079892788 11:26079031-26079053 TGTTATCTATTTCCAAGTAAGGG + Intergenic
1080204691 11:29715122-29715144 TGTGATATATATACACACAAAGG - Intergenic
1081262652 11:40979907-40979929 TGTTATATTTCTCCACAGAGAGG - Intronic
1082709988 11:56542876-56542898 GGTCATATATGGCCACATAGCGG + Exonic
1085924199 11:80996115-80996137 TGTTATTTATTTCAACAAAAAGG + Intergenic
1088551530 11:111018435-111018457 TGATAGATATTTCCAAATAAAGG + Intergenic
1088584285 11:111347187-111347209 TGTTACAGATTTCCACCTAATGG + Intergenic
1088774170 11:113066261-113066283 TCTCGTAAATGTCCACATAAAGG + Intronic
1089929356 11:122294155-122294177 TGTTATAAATATTCACATACAGG - Intergenic
1090112771 11:123933454-123933476 TGTTGTACATTTCCACATATAGG + Intergenic
1093205417 12:16243047-16243069 TAGTAAATATGTCCACATATGGG + Intronic
1093588731 12:20873409-20873431 TGTGATAAATGTCCACATACTGG + Intronic
1095071846 12:37861717-37861739 TGATATATATGTATACACAATGG - Intergenic
1097123394 12:56753391-56753413 GGTTATTTATTTCCACATATTGG - Intronic
1097957623 12:65502307-65502329 TGTTATATATTTACAATTAAAGG + Intergenic
1098800765 12:74954677-74954699 TTTCATATATGTATACATAATGG + Intergenic
1098843440 12:75505981-75506003 AGTTACATATGTCCAAATGACGG - Intronic
1100372903 12:93985172-93985194 TGTTACATATGTATACATGATGG + Intergenic
1100920514 12:99479961-99479983 TTTGATATATGTATACATAATGG - Intronic
1102090176 12:110179852-110179874 TATAATATATGTACATATAATGG + Intronic
1102387842 12:112525466-112525488 TGTTAAAGATGGCCACATTAGGG - Intergenic
1105897199 13:24726401-24726423 TGTTTTAGATGGCCACAGAATGG - Intergenic
1106771457 13:32964682-32964704 TGCTATAAATATCCACATAAAGG + Intergenic
1106962956 13:35022855-35022877 TGTGATAAATGTTCACAAAATGG + Intronic
1109389909 13:61680063-61680085 TGTGATTTATGTCAACATAAAGG - Intergenic
1109760997 13:66828944-66828966 TGTTATATACAACCATATAAAGG + Intronic
1110748519 13:79084989-79085011 TGTTAATTATTTTCACATAATGG - Intergenic
1112792739 13:103021022-103021044 TGTTTAATTTGGCCACATAAAGG - Intergenic
1113319356 13:109217766-109217788 TAATATATATATACACATAAAGG - Intergenic
1114049430 14:18910570-18910592 TTATATATATGTTTACATAAAGG - Intergenic
1114113133 14:19491361-19491383 TTATATATATGTTTACATAAAGG + Intergenic
1114698773 14:24654836-24654858 TGTTATATATATACACACAATGG - Intergenic
1114826095 14:26081927-26081949 TTTTATAGATATCAACATAAAGG + Intergenic
1115075995 14:29391022-29391044 TGTTATATATGTTTTCCTAACGG - Intergenic
1115377059 14:32688473-32688495 TGTTATGTATGTCCTCAAGAAGG + Intronic
1117565265 14:56988051-56988073 TGATATAATTGTCCACATAATGG + Intergenic
1120549044 14:85846619-85846641 GGATATATATATCCATATAAAGG - Intergenic
1123951063 15:25275796-25275818 TGGTATATAAGTCTCCATAAGGG + Intergenic
1124733407 15:32220477-32220499 TGTTATTTGTGACAACATAAAGG - Intergenic
1124789074 15:32709692-32709714 TATTATACATGTGCATATAAAGG + Intergenic
1125013231 15:34903391-34903413 CCTTACACATGTCCACATAATGG - Intronic
1125047181 15:35255207-35255229 TGCTAAATATGTCGTCATAATGG - Intronic
1125899450 15:43331254-43331276 TGTTGAATATGTCCCCAGAAAGG + Intronic
1126988223 15:54339628-54339650 ATATATATATCTCCACATAATGG - Intronic
1127337547 15:58004246-58004268 TGTTTTATTTCTCCCCATAAAGG - Intronic
1128186469 15:65647099-65647121 GGTTATATGTGTGCTCATAAGGG - Intronic
1129139350 15:73583072-73583094 TCTCATCTCTGTCCACATAAGGG + Intronic
1131210791 15:90494045-90494067 TGTTATATCTATCTGCATAATGG - Intronic
1133197408 16:4181156-4181178 TCTTATATATGTCTATATATAGG - Intergenic
1133197409 16:4181179-4181201 TCTTATATATGTCTATATATAGG - Intergenic
1133770009 16:8862390-8862412 TGTTATAATTGTCATCATAAAGG + Intronic
1135965070 16:27028754-27028776 TGTTATATGTGTCCTCAGATAGG + Intergenic
1137651966 16:50128263-50128285 TTTGATATATGTACACATTATGG + Intergenic
1140170839 16:72602311-72602333 TGTTGTATATGTCTTAATAAGGG - Intergenic
1146703827 17:34985149-34985171 TGTTATATATAGCCATATATAGG - Intronic
1146860249 17:36291396-36291418 TGTTATATATATGTATATAATGG + Intronic
1147090576 17:38095490-38095512 TGTTATATATATGTATATAATGG + Intergenic
1147106637 17:38225036-38225058 TGTTATATATATGTATATAATGG - Intergenic
1148422884 17:47563495-47563517 TGTTATATATATGTATATAATGG + Intronic
1150549144 17:66192525-66192547 TCTGATGTCTGTCCACATAACGG - Intergenic
1150831755 17:68527575-68527597 TGTGAAATATGTCAACATACTGG + Intronic
1153801423 18:8674028-8674050 TGTTATTTATGTTGACATAATGG - Intergenic
1155768234 18:29664353-29664375 TGTTATACATATTCACATAGGGG + Intergenic
1156089569 18:33449647-33449669 TGTGACACATGACCACATAATGG - Intergenic
1156432793 18:37093638-37093660 TGATGTATAGGGCCACATAATGG + Intronic
1157655965 18:49388538-49388560 TTTTATATATAAACACATAATGG + Intronic
1159725652 18:71954101-71954123 TGCCATATTTGTCCACTTAAGGG + Intergenic
1159967829 18:74613618-74613640 TGTTCTGTATTTCCCCATAAGGG - Intronic
1165648459 19:37466040-37466062 TGTTCTATATGTGTGCATAATGG - Intronic
926592540 2:14755174-14755196 TGATATATATATCCACATGCAGG - Intergenic
926804862 2:16698835-16698857 TGTTATATATATATATATAATGG + Intergenic
927118627 2:19930297-19930319 TGTTATTGAAGGCCACATAAAGG + Intronic
927627018 2:24732524-24732546 TTTTACATGTGTCCACTTAAGGG + Intronic
927823617 2:26291327-26291349 TGATATATATGTAAATATAATGG - Intergenic
928708241 2:33975493-33975515 TGATATATATGTACACACACAGG + Intergenic
928804571 2:35135040-35135062 TCATATATCTGTCCACAAAATGG - Intergenic
929441486 2:41968659-41968681 TGAGATATATGTCAAAATAAAGG - Intergenic
931410815 2:62029427-62029449 TTTTATTTATGCCCATATAATGG - Intronic
933434614 2:82232044-82232066 TATTATATATAGCCACACAAAGG - Intergenic
933882629 2:86685706-86685728 TGTTAGGTATGTACACATTAAGG + Intronic
935385984 2:102500665-102500687 TGTTTGATATCTGCACATAAGGG + Intronic
938426777 2:131198904-131198926 TTATATATATGTTTACATAAAGG - Intronic
938979437 2:136511939-136511961 TGATATATATGTATACATCATGG + Intergenic
939557833 2:143698137-143698159 TGTTATATAGGTCCACTCAGAGG - Intronic
939899960 2:147840018-147840040 TATAATACAAGTCCACATAAGGG - Intergenic
940711892 2:157172531-157172553 TTTTAGATATGGCCACAAAATGG - Intergenic
941215673 2:162705515-162705537 TGTTAGTTATGTCTACATATAGG + Intronic
942530721 2:176906959-176906981 TGTTATATAAGTGCTCAAAATGG - Intergenic
942617161 2:177804711-177804733 TTATATATATATCCACATAATGG + Intronic
943201248 2:184827637-184827659 TGTTCTAGATGTTCAGATAATGG + Intronic
943238961 2:185360419-185360441 TGTTATATATATATATATAAAGG + Intergenic
944090031 2:195896982-195897004 TGTTACATATTTCCAGATATAGG - Intronic
944207741 2:197174531-197174553 ATGTATATATGTGCACATAAAGG + Intronic
944303113 2:198147037-198147059 TGTTTTATAAGTTCACAAAATGG + Exonic
944648345 2:201803127-201803149 ATTCATATATGTCCACACAATGG - Intronic
945563423 2:211366786-211366808 TGCTATATATGTTTACTTAATGG - Intergenic
947024702 2:225724183-225724205 ATTTATATTTGTCTACATAATGG + Intergenic
947426326 2:229986196-229986218 TGTTATATATTAACACAAAAAGG + Intronic
1168863895 20:1067697-1067719 TGGTATATTTGTCCACTTATGGG - Intergenic
1170636970 20:18115443-18115465 TGTTATGTGTGTACACATTAAGG + Intergenic
1175554314 20:59837066-59837088 TGCTATAATTGTCCACCTAACGG - Intronic
1175557281 20:59875560-59875582 TGTTGTATATTACCACATACAGG + Intronic
1176964881 21:15201321-15201343 TGTATTATATGTCCATAAAATGG + Intergenic
1178667542 21:34562136-34562158 TGTTTTATATGCCTTCATAATGG - Intronic
1180467913 22:15632947-15632969 TTATATATATGTTTACATAAAGG - Intergenic
1181185470 22:21100407-21100429 TGTTATATATGACCTTATGAGGG + Intergenic
1181934823 22:26430466-26430488 TGTTATTTCTGTCCTCATCAGGG - Intronic
950020561 3:9784548-9784570 ATTTAAATATGTGCACATAAGGG - Intronic
950945760 3:16944536-16944558 TCTAATATGTGTCCTCATAAGGG + Intronic
952351822 3:32546670-32546692 TGAGTTATATGTCCACCTAAGGG + Intronic
953728189 3:45419457-45419479 TTCTGTATATGTCCAAATAATGG + Intronic
954901424 3:54023381-54023403 TGTCATATATGTACTCACAAGGG - Intergenic
957759489 3:84537115-84537137 TGTTACATGTGTTCATATAAGGG + Intergenic
957991440 3:87632136-87632158 TGATATATATATACACACAATGG + Intergenic
958975619 3:100665244-100665266 AGTTATAAATATCAACATAATGG - Intronic
959451671 3:106511387-106511409 TGTTATATATTTATATATAAAGG + Intergenic
959859593 3:111202292-111202314 TGTGATATATATCCATACAATGG - Intronic
960249858 3:115439857-115439879 TTTTATATATGTCTAAATAAAGG + Intergenic
961095957 3:124156910-124156932 TGCTCTATATGTACACAGAATGG + Intronic
961632834 3:128313734-128313756 ATTCATATATGTCCACATGAGGG - Intronic
962182052 3:133216789-133216811 TGGTATATATATACACACAATGG - Intronic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
963357509 3:144228286-144228308 TGTGATATATATACACACAATGG + Intergenic
963674489 3:148292180-148292202 TATTATATATTTCCATATATAGG + Intergenic
963710560 3:148742434-148742456 TATTTTTTATTTCCACATAAAGG + Exonic
964565574 3:158048011-158048033 TTTTATATATGTTTACATTATGG - Intergenic
965297221 3:166963882-166963904 TGTGATATATATACACAAAATGG - Intergenic
965347535 3:167570636-167570658 TGCTATACATGTATACATAATGG + Intronic
966303580 3:178506058-178506080 TATTATCGATGTACACATAACGG + Intronic
967364747 3:188673310-188673332 TGTTATTTGTTTCCACATATAGG - Intronic
969941043 4:10731977-10731999 TGTTGTAAATGTCCTCATTATGG + Intergenic
970860320 4:20695229-20695251 ATTTATATATATCCACAAAATGG - Intergenic
971089403 4:23323249-23323271 TCCTTTATAAGTCCACATAATGG + Intergenic
971647375 4:29226209-29226231 TGTGAGATATTTCCAAATAAAGG - Intergenic
971887227 4:32466496-32466518 TATTATATAAGTCAAAATAATGG + Intergenic
972247524 4:37260866-37260888 TGTTGTATGTGGCTACATAATGG - Intronic
973973089 4:56234433-56234455 TGTTATATAGATCCACACAATGG - Intronic
974475645 4:62375881-62375903 TATTATATATTTCCATATATAGG + Intergenic
975369860 4:73572467-73572489 TATTATATATGTATACATTATGG - Intronic
975982267 4:80174534-80174556 TATTATATATATACATATAAAGG + Intergenic
978899818 4:113934366-113934388 TGGTACATATGTACACACAAGGG + Intronic
979149928 4:117298598-117298620 TGTTATCAATCTCCACATAGAGG + Intergenic
979297525 4:119050671-119050693 TGTTATATAGTCCCACAAAAGGG - Intronic
980797578 4:137704163-137704185 TGTTAGATATGTTTAAATAATGG + Intergenic
981843960 4:149145319-149145341 TGTTAAATATGTCCAGACACCGG - Intergenic
982385110 4:154792619-154792641 TGTGATATAAGTACATATAAGGG + Intronic
985943002 5:3153530-3153552 TGTTATTTATGTCAAGAAAATGG + Intergenic
987378462 5:17260114-17260136 TGTTATTTATTTGCACTTAACGG - Intronic
988058824 5:26139306-26139328 TGTTCTATTTGTTCACATATAGG + Intergenic
988678476 5:33459169-33459191 TGGTATATATATCCATATACTGG + Intronic
993605253 5:89982451-89982473 TGTTAGAATTGTACACATAAAGG + Intergenic
994172961 5:96678530-96678552 TTTTATATATGGCAATATAACGG - Intronic
994920807 5:106040470-106040492 TGTTATATATGTGCACAACTTGG - Intergenic
996244944 5:121250631-121250653 TGTGATATATGTGTACATAATGG - Intergenic
996311059 5:122105953-122105975 TGTTATTTTTGTCTTCATAAAGG - Intergenic
996553124 5:124750492-124750514 TGGTTTATATGTCCCAATAAAGG - Intergenic
998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG + Intronic
1000924917 5:167181532-167181554 TGTTATATGTGTTGACCTAAAGG - Intergenic
1001137915 5:169117695-169117717 TGTTAGATATCTCCAAAGAACGG - Intronic
1001920908 5:175598666-175598688 TTATATATATCTCCACATCATGG - Intergenic
1004221355 6:13749435-13749457 ATCTATATATGTCAACATAATGG - Intergenic
1005662227 6:28010308-28010330 TGATATATATCTCCACTCAAGGG - Intergenic
1006524648 6:34593421-34593443 TGTTGTATATTCCCACTTAACGG + Intronic
1008206349 6:48663626-48663648 AGTTATATATGTGAACATGAAGG + Intergenic
1008778451 6:55070455-55070477 TGTTATTTATGTAAACATAATGG - Intergenic
1009743061 6:67773205-67773227 CGTTATATATGTACACAGTAAGG + Intergenic
1009837976 6:69029189-69029211 TGTTCTATATTTCTACATCAAGG + Intronic
1010205287 6:73316941-73316963 TGTTACAAAGGTCCACAAAATGG + Intergenic
1010925641 6:81742705-81742727 TGTTATAAATATCTACATAATGG + Intronic
1011901959 6:92309568-92309590 TGTTCTTTATGTCTGCATAATGG + Intergenic
1011977964 6:93330643-93330665 TGTGGTATATATCTACATAATGG - Intronic
1012097551 6:94982689-94982711 TGTATTGTATGTACACATAAGGG - Intergenic
1012385548 6:98677839-98677861 TGTTATAAACATCCACATGAAGG - Intergenic
1014173913 6:118310536-118310558 TGTTATAAATGTTGACAGAAAGG - Intronic
1014515322 6:122370839-122370861 TGTTATAGATGTTAACATTAGGG + Intergenic
1014667142 6:124253420-124253442 TGTTATTTATCTCCATATGAAGG + Intronic
1015155721 6:130093683-130093705 TGTTTTATTTTGCCACATAAAGG - Intronic
1015665216 6:135620480-135620502 TATAAAATAGGTCCACATAAAGG - Intergenic
1016109923 6:140210296-140210318 TCATATCTATGTCAACATAATGG - Intergenic
1016262323 6:142187095-142187117 TGTTTTATATATCCAAATATGGG - Intronic
1018777756 6:167033932-167033954 TGTCATCTATTTCCACAGAAAGG - Exonic
1020243359 7:6412249-6412271 GGTGATATATGTCCACGTCAAGG - Intronic
1020372756 7:7452204-7452226 TGTTATCTAACTCTACATAATGG - Intronic
1020534229 7:9373900-9373922 TTTTATATCTTTCCACCTAAAGG + Intergenic
1021166278 7:17346307-17346329 TGTTTTTTATATCCAGATAAAGG - Intergenic
1021423819 7:20475751-20475773 TATTTCTTATGTCCACATAAAGG - Intergenic
1022195053 7:28056892-28056914 TGATATATATGTATTCATAAAGG - Intronic
1022775253 7:33520661-33520683 ATTTATATATTTCCACATAAGGG - Intronic
1024501817 7:50118107-50118129 TGTTAAATAGGTCAACATAGGGG - Intronic
1024503480 7:50139729-50139751 TGTTATAAACGTTCACATATAGG - Intronic
1024698424 7:51880715-51880737 GGGTATATATGTACACACAATGG + Intergenic
1024854548 7:53763024-53763046 TGTGATATATATACACACAATGG - Intergenic
1024874490 7:54006306-54006328 GGCTATATATGTCAACTTAAAGG - Intergenic
1025242103 7:57285612-57285634 TGTTTTATATATATACATAATGG - Intergenic
1025591781 7:62869666-62869688 TGATATTTATGACCACATAGAGG + Intergenic
1026599563 7:71765847-71765869 TGTGATATATATACACATCATGG - Intergenic
1026670274 7:72384195-72384217 TTTTATGTAAGTCCACATAATGG - Intronic
1028876656 7:95831512-95831534 AGATATATATGTCCAGAAAAGGG + Intronic
1029064236 7:97832676-97832698 ATTTATATATGTACACGTAATGG - Intergenic
1030427790 7:109401579-109401601 TGTTATATATTTCTACTTCATGG + Intergenic
1030584229 7:111397181-111397203 TAGTATATATGTCTAGATAAAGG - Intronic
1030684783 7:112474105-112474127 TGTGATATATATCCATACAATGG - Intronic
1030838182 7:114314296-114314318 AGTTATATCTGTCAACAGAAAGG - Intronic
1031534075 7:122912179-122912201 TTTTATATATATACACACAAAGG - Intergenic
1032063382 7:128744472-128744494 TGTTATATATGTGGGCACAAAGG + Intronic
1033466246 7:141592614-141592636 TGTTAAATATTTCCATATTATGG - Intronic
1034305934 7:150045453-150045475 GGATATATATGTGCAGATAATGG + Intergenic
1034800905 7:154055195-154055217 AGATATATATGTGCAGATAATGG - Intronic
1038102699 8:24396601-24396623 TTGTCTATATGTGCACATAAGGG - Intronic
1040714077 8:50225959-50225981 TGTTAATTATGTACACATATAGG + Intronic
1042480708 8:69299085-69299107 TAATAGATATGTGCACATAATGG - Intergenic
1043088728 8:75871320-75871342 TGTTATATAGGTAAACATAGTGG + Intergenic
1043869536 8:85416739-85416761 TAATATATATCTCCACATCATGG + Intronic
1044070388 8:87752896-87752918 TGTTACATATGTATACATCAGGG + Intergenic
1044446460 8:92282609-92282631 AGCTATATATGTCAACAAAAGGG - Intergenic
1044843467 8:96358107-96358129 TGTTAAATATGTTCACATTGTGG - Intergenic
1045413170 8:101940355-101940377 TGTTATATATGTCCACATAAGGG - Intronic
1046512695 8:115219399-115219421 TGTTATATAAATTCATATAAAGG - Intergenic
1048518361 8:135131297-135131319 TGTTATAAATCTACAAATAAGGG + Intergenic
1049139855 8:140943525-140943547 TGCTATAAATGTTCACATAGAGG + Intronic
1050219826 9:3374497-3374519 TGTGGTATATATCCATATAATGG + Intronic
1050540774 9:6667593-6667615 TTTTATATATGTTAAAATAAAGG - Intergenic
1051062244 9:13057893-13057915 TCTTATATATATCCACAGTACGG - Intergenic
1051761769 9:20474918-20474940 TATTACATATGTCCACATCCAGG + Intronic
1052407743 9:28083585-28083607 GGTTAGATTTGGCCACATAATGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055141249 9:72879697-72879719 TGATATATATGTATACACAATGG + Intergenic
1055345845 9:75337738-75337760 TGATATATATGTACATATGATGG - Intergenic
1058149178 9:101445081-101445103 TTTTAGTTATGTCTACATAAAGG - Intergenic
1058371053 9:104268161-104268183 TGTGGTATATGTACACAAAATGG + Intergenic
1058544665 9:106048194-106048216 TTTTATTCATGTGCACATAAGGG + Intergenic
1059088238 9:111328049-111328071 GGTTACAAATGGCCACATAACGG + Exonic
1185685261 X:1923388-1923410 TTTGATATATGTACACATCATGG - Intergenic
1185764031 X:2710069-2710091 TGCTATATATTTCCACAGAAAGG - Intronic
1187810907 X:23175539-23175561 TGTAATCTATTTCCACACAATGG + Intergenic
1188047647 X:25446143-25446165 TGATATATATGTACATACAATGG + Intergenic
1188274135 X:28179025-28179047 TTTTATATATGTATACATTATGG + Intergenic
1188318696 X:28708587-28708609 TGTGGTATATATACACATAAGGG + Intronic
1188646655 X:32576829-32576851 TGTTCTTTATATCCAAATAATGG + Intronic
1188703534 X:33296726-33296748 TGTTATATAAAACCAAATAATGG - Intronic
1189266179 X:39718335-39718357 TTTTATTTATCTTCACATAAAGG - Intergenic
1189638073 X:43033992-43034014 TGTGGTATATGTCCACACAATGG - Intergenic
1190894348 X:54601943-54601965 TGGTATGTATATCCATATAATGG - Intergenic
1190924016 X:54885234-54885256 TGGTATGTATATCCATATAATGG + Intergenic
1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG + Intronic
1192862324 X:75088678-75088700 TGTAACATATGTATACATAATGG + Intronic
1194380836 X:93189867-93189889 TGTTATAATTTTCCACATTAAGG + Intergenic
1194618162 X:96133374-96133396 TGTTCTATTTGTCCAGCTAACGG + Intergenic
1195609025 X:106843053-106843075 TGTGGTATATATCCATATAATGG - Intronic
1195699693 X:107694513-107694535 TGTTAGACATGTACACATTAAGG + Intergenic
1197695467 X:129545323-129545345 TGTTATTTAAATCCACATATAGG - Intronic
1198923441 X:141757929-141757951 GGATATATATGTGCATATAAAGG + Intergenic
1198923446 X:141758013-141758035 TGATATATACGTGCATATAAAGG + Intergenic
1199495765 X:148450603-148450625 AGTTTTCTATGTCCACAAAATGG - Intergenic
1201747238 Y:17390764-17390786 TTTTACATATGTCCACCTATTGG - Intergenic