ID: 1045414303

View in Genome Browser
Species Human (GRCh38)
Location 8:101951375-101951397
Sequence CTTCACTCTAAGATTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045414303_1045414307 19 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1045414307 8:101951417-101951439 GACGGAAGAATTTAGAGAAGAGG No data
1045414303_1045414306 1 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1045414306 8:101951399-101951421 CAGTGAGGAGCTGGCGAAGACGG No data
1045414303_1045414305 -8 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045414303 Original CRISPR CTTCACTCTAAGATTGCTGA AGG (reversed) Intronic
907697781 1:56751340-56751362 CTAGACTCTAAGTTTCCTGAAGG + Intronic
910341058 1:86188179-86188201 CTTCACTATAAGAATTTTGAAGG + Intergenic
920730086 1:208475235-208475257 CTTCACTCCAAAAGGGCTGAGGG - Intergenic
920856841 1:209669734-209669756 CTTCACTATAAGCTTCTTGAGGG + Intergenic
923463990 1:234232065-234232087 CCTCACCCCAAGCTTGCTGAGGG - Intronic
924583658 1:245343163-245343185 CTTCACTATAAGTTTGTTTATGG + Intronic
1063179401 10:3584228-3584250 CTCCACACTAAGGTTTCTGAAGG + Intergenic
1066530091 10:36328057-36328079 CTTGACTATAAGTTTGATGAAGG + Intergenic
1067249374 10:44574338-44574360 CTTCACTCTCAAAATGTTGAAGG - Intergenic
1074842775 10:117371999-117372021 CTAGACTCTAAGCTTCCTGAGGG + Intronic
1081613967 11:44579590-44579612 CTCTCCTCTGAGATTGCTGAGGG - Intronic
1084719996 11:70899364-70899386 CATGACTGTAAGATTCCTGAGGG + Intronic
1085476047 11:76789507-76789529 AGTGACTCTAAGTTTGCTGATGG - Intronic
1086940439 11:92792229-92792251 CTTGACTCTAAGCTTCTTGAGGG + Intronic
1087073936 11:94111155-94111177 CTTGACTCTGAGCTTGTTGAGGG - Intronic
1087813046 11:102629332-102629354 CTATACTCAAAGACTGCTGAAGG - Intergenic
1088053279 11:105544817-105544839 TTTCACTCTAAGATGGAAGAGGG - Intergenic
1090446343 11:126767961-126767983 CTTCACCCTATGGTAGCTGATGG - Intronic
1092020976 12:5201974-5201996 CTTCACTCTAATATGGCTGCTGG + Intergenic
1092089976 12:5796648-5796670 CTGCACTGTGAGACTGCTGATGG - Intronic
1092964561 12:13629168-13629190 ACTCACTCTAAGATTGCCCAGGG + Intronic
1094804251 12:34072844-34072866 CTTTTCTCTAAGAATGTTGAGGG - Intergenic
1096356323 12:50943828-50943850 CTTAACTCTAAGTGTCCTGATGG + Intergenic
1099680374 12:85820389-85820411 CTTCACTTTAGGAATTCTGAGGG + Intronic
1100404401 12:94260854-94260876 CTTACCTCTGACATTGCTGAGGG - Intronic
1101269013 12:103123202-103123224 CTTCACTCTAGGATTGGTGTGGG - Intergenic
1102427441 12:112855264-112855286 CTTCTCTCCCAGATTGTTGATGG + Intronic
1103639332 12:122336676-122336698 CTTCACTCAAATTTTCCTGAAGG + Exonic
1106044777 13:26128851-26128873 CTTCACGCTAAGTTCCCTGAGGG - Intergenic
1107255510 13:38421478-38421500 CTTTACTTTAAGATCTCTGATGG + Intergenic
1110453988 13:75669428-75669450 CTTCACTCTGAGATTGCTCTAGG - Intronic
1113360405 13:109625814-109625836 CTTCACTCTAAGAGTGGTCTTGG + Intergenic
1115998957 14:39222596-39222618 ATTCACTCTAATATCTCTGAAGG - Intergenic
1120179356 14:81327867-81327889 CTTCAGTCAAAGAGTGGTGAAGG + Intronic
1120566671 14:86067890-86067912 CCTCACTCCAATGTTGCTGAAGG + Intergenic
1120576273 14:86185314-86185336 CTTCTCTCTCAGAATGCAGATGG + Intergenic
1122448697 14:101785829-101785851 TTTCAGTCTAATATTGCTGAAGG + Intronic
1126829336 15:52583996-52584018 CTTCAATCTGTTATTGCTGATGG - Intronic
1130322269 15:82851045-82851067 TTTCACACTGAGAATGCTGAAGG - Intronic
1130854294 15:87827333-87827355 CTAAACTCTAACATTGCTGAGGG - Intergenic
1133867437 16:9657612-9657634 CTGCACTACAAGACTGCTGAAGG + Intergenic
1134141046 16:11719728-11719750 CTAGACTGTAAGATTTCTGAGGG - Intronic
1139168685 16:64603287-64603309 CTTCACTCTACCTTTGCTGGTGG - Intergenic
1141011715 16:80406976-80406998 CTCCACTTTAAGATTCATGAAGG - Intergenic
1141541294 16:84724298-84724320 ATTCAATCTAAAATTTCTGAAGG + Intronic
1141629604 16:85280034-85280056 TTTCACCCAAAGGTTGCTGAGGG + Intergenic
1146231200 17:31111731-31111753 CTGCACTGTAAGATTACTGAAGG + Intronic
1146432988 17:32816185-32816207 CTTGACTCTAAGTTTGATCAGGG - Intronic
1147368357 17:39974375-39974397 CTTCCCTAGAAGTTTGCTGAGGG - Exonic
1158963327 18:62604003-62604025 CTGCACTCAAGGATTGCTGAGGG + Intergenic
1159716099 18:71825283-71825305 CTACACTCTAAAATAACTGATGG + Intergenic
1162753507 19:12843394-12843416 CTGCACTCTAAGATTCCTCAAGG - Intronic
1166897396 19:46032597-46032619 CTTTGCTCTAAGATTGCAGTGGG - Intergenic
928152190 2:28841658-28841680 CTAGACTCTAAGATTCTTGAAGG + Intronic
933600855 2:84328531-84328553 TTTCACACTAAGATTTTTGAAGG + Intergenic
933889707 2:86756413-86756435 CTTTACTGTAGGATTACTGATGG - Intronic
935975180 2:108571127-108571149 CTGCACTCTAAGCTTCTTGAGGG - Intronic
937896816 2:126982605-126982627 TTTCATTCTAAGTTTGCTGAGGG - Intergenic
937902070 2:127027572-127027594 CATTACTCTAAAATTGGTGAAGG + Intergenic
938817622 2:134919577-134919599 TTTCACTCTAACAGCGCTGAGGG - Intronic
940001554 2:148971450-148971472 CTGCACACTAAGGTTGTTGATGG + Intronic
940081576 2:149809049-149809071 TTTCACTCTCAGGATGCTGATGG + Intergenic
946127258 2:217573903-217573925 CTTCAATCAAGGACTGCTGAAGG - Intronic
946276182 2:218633550-218633572 CTTCTCTCTCAGACTGCTGAGGG + Intronic
946674266 2:222141637-222141659 CTTAACTCTAAAATTAATGAGGG + Intergenic
948307128 2:236956688-236956710 CTTCACTCCAAGCTTACTGTTGG + Intergenic
1169076669 20:2764194-2764216 CTTCACTGTGAGAGTCCTGATGG + Intergenic
1169313118 20:4564626-4564648 CTTGACTTTAAGAATGTTGATGG + Intergenic
1169977293 20:11344565-11344587 ATTCACTCAAAGACTGCTGCTGG + Intergenic
1172300423 20:33845869-33845891 CTTCCCTCTGACATTACTGATGG + Intronic
1172780932 20:37436609-37436631 CTGCACTAAAAGATGGCTGATGG + Intergenic
1172830091 20:37826142-37826164 CTTCTCTCTATGAATGCAGAGGG - Intronic
1174339910 20:49889093-49889115 CCTCACCCTGAGATGGCTGAGGG - Exonic
1174905410 20:54545203-54545225 TTTCACTCTTATATTGCAGAAGG + Intronic
1175296594 20:57913092-57913114 CTGGAGTCTAAGATTCCTGAGGG - Intergenic
1185117232 22:48944806-48944828 CCTCACGCTCTGATTGCTGATGG - Intergenic
951059610 3:18189758-18189780 GGTCACTGGAAGATTGCTGATGG + Intronic
953433597 3:42859679-42859701 CTTCTCTTTAAGAATGTTGAAGG - Intronic
953726364 3:45402710-45402732 TTCCACTTTAAGATGGCTGAGGG + Intronic
955066377 3:55536788-55536810 GATCACTCTCAGAATGCTGATGG + Intronic
957535185 3:81493131-81493153 TTTCACTTTTAGATTGCTCATGG - Intronic
959367521 3:105481110-105481132 TTTCACCCTAAGGCTGCTGATGG - Intronic
959974890 3:112447698-112447720 CTTCACTCTAATAACCCTGAGGG - Intergenic
962284987 3:134077946-134077968 TTTCACTCTAATACAGCTGAGGG - Intronic
969407134 4:7001002-7001024 CTGGACTCTAAGCTTCCTGAGGG + Intronic
972013243 4:34211037-34211059 TTTCACTCTAAGAAGTCTGAAGG + Intergenic
973058602 4:45691273-45691295 CTTTCCTCCAAAATTGCTGAGGG + Intergenic
974046284 4:56901469-56901491 TATGACTCTAATATTGCTGATGG - Intergenic
976989515 4:91348147-91348169 ATTTAATCTTAGATTGCTGATGG + Intronic
977869295 4:102070772-102070794 CTTCACTCAAACATTACTCATGG - Intronic
978905531 4:114001242-114001264 CTTCACTGTAAGCTTCCAGAGGG - Intergenic
979040301 4:115782773-115782795 CTTCACCTTAAGAATGCTGTAGG + Intergenic
981651397 4:147063336-147063358 ATTCATTCAAAGATTACTGAAGG - Intergenic
985549712 5:526830-526852 CTGCACTCCAAGGTTGCTGGAGG + Intergenic
987859893 5:23471134-23471156 CTACATTATAACATTGCTGATGG + Intergenic
988951147 5:36262032-36262054 CTTTACTTTCAGATTTCTGAGGG - Exonic
995321527 5:110839827-110839849 CTACTCTCTAAGATCACTGATGG + Intergenic
995958586 5:117811033-117811055 CTTCACTCTTATATTGCTGATGG + Intergenic
998456379 5:142277025-142277047 CTCCACTGTAAGAATCCTGATGG + Intergenic
998480605 5:142459576-142459598 CTTCACTCTGAAATTGGTGCAGG + Intergenic
998796906 5:145830077-145830099 CTTCAATCTAAAATTGCACAGGG + Intronic
999463103 5:151773087-151773109 TTTGAATCTCAGATTGCTGATGG + Intronic
999735792 5:154511985-154512007 GTTCTCTCTAAGATTTCTGTGGG + Intergenic
1003995427 6:11536144-11536166 CCTCACTTTAAGATTCTTGATGG - Intergenic
1005153254 6:22776526-22776548 CTTCACTGTCAGATTGCAAATGG + Intergenic
1005534973 6:26745824-26745846 CCTCACTCTGAGTTTGCGGAGGG - Intergenic
1009241770 6:61193760-61193782 CTTCACTCTAAAATTGGAGTGGG + Intergenic
1011778941 6:90764779-90764801 CTACATTCTAAGATGCCTGATGG + Intergenic
1013402211 6:109809842-109809864 CTTCCCTGAAAGATTGCAGATGG + Intronic
1014605384 6:123467450-123467472 CTGCTCTCTAACATGGCTGATGG + Intronic
1015886454 6:137923243-137923265 CTACACTCTTTGATTGCTGAGGG - Intergenic
1020908929 7:14103856-14103878 CATCACACGAAGGTTGCTGAGGG + Intergenic
1021995195 7:26172611-26172633 CTTCACCTTTAGATTGTTGAAGG + Intronic
1022832922 7:34086386-34086408 CTTAACTCTAAGATTGAGGAGGG + Intronic
1022963369 7:35451194-35451216 CTTGACTCTGAGCTTGCTGCAGG - Intergenic
1023224144 7:37951573-37951595 CTTCACTCTACGAATACTTAGGG - Exonic
1023521565 7:41055017-41055039 CTTAAATCAAAGAATGCTGATGG + Intergenic
1028938282 7:96490042-96490064 CTTGACTATAAGATCCCTGAGGG + Intronic
1030887636 7:114958406-114958428 CTTTACTCTGAAATTGATGAAGG + Intronic
1031918292 7:127583264-127583286 CTTCTACCTGAGATTGCTGACGG + Exonic
1034194610 7:149236646-149236668 CCTCATCCTAAGGTTGCTGATGG - Intergenic
1035899204 8:3439224-3439246 AGTCACTCAAACATTGCTGATGG - Intronic
1036812126 8:11874480-11874502 CTGCACTCTGAGGTTCCTGAGGG + Intergenic
1037434395 8:18847295-18847317 CTTCACTCTGAGTTGACTGATGG - Intronic
1037682463 8:21108828-21108850 CTTTACTTTGAGAATGCTGATGG + Intergenic
1039990575 8:42484524-42484546 CCTCACTCTGAGAATGCTCATGG + Intronic
1041195989 8:55401748-55401770 TTTCACTCAAAGATCCCTGAAGG + Intronic
1045414303 8:101951375-101951397 CTTCACTCTAAGATTGCTGAAGG - Intronic
1047207446 8:122814305-122814327 TTTCACTGTTGGATTGCTGAAGG + Intronic
1048966894 8:139621656-139621678 CTACACAATAAGATTACTGAAGG + Intronic
1052030395 9:23621868-23621890 CTTTCCTATAAGATTGCTAAGGG + Intergenic
1055148536 9:72965698-72965720 TTTCATTATAACATTGCTGAGGG - Intronic
1057915124 9:99049555-99049577 CTTCTCTCTCAGGTTGCTCAGGG - Intronic
1058241340 9:102565279-102565301 ATTTACTCTAAGATTTCTGGGGG - Intergenic
1058291649 9:103249335-103249357 TATCACTCATAGATTGCTGATGG + Intergenic
1060067475 9:120515585-120515607 GTGCACTCTAACATTGCTGGTGG + Intronic
1060564116 9:124574379-124574401 CTTAACTATAATATTACTGAAGG + Intronic
1188327479 X:28823284-28823306 GTTCATTCAAAGATTGCTAATGG + Intronic
1189627681 X:42916843-42916865 CTGCAATCTATAATTGCTGAGGG - Intergenic
1189873143 X:45405042-45405064 CTTCACTCCCAGATCACTGAAGG + Intergenic
1191881539 X:65847858-65847880 CTCCACTCTAACATTCCAGATGG + Intergenic
1194136690 X:90152330-90152352 CTTCAGTCTATGTTTGCTCAAGG - Intergenic
1194154701 X:90372826-90372848 CTTTCGTCTAAGATTGCTGTAGG - Intergenic
1196118715 X:112025266-112025288 TTTATCTCTAAGCTTGCTGATGG + Intronic
1197744050 X:129918929-129918951 CTACTCTCTAATACTGCTGAGGG - Intronic
1200482436 Y:3722280-3722302 CTTCAATCTATGTTTGCTCAAGG - Intergenic