ID: 1045414303

View in Genome Browser
Species Human (GRCh38)
Location 8:101951375-101951397
Sequence CTTCACTCTAAGATTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045414303_1045414307 19 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG No data
Right 1045414307 8:101951417-101951439 GACGGAAGAATTTAGAGAAGAGG No data
1045414303_1045414306 1 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG No data
Right 1045414306 8:101951399-101951421 CAGTGAGGAGCTGGCGAAGACGG No data
1045414303_1045414305 -8 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG No data
Right 1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045414303 Original CRISPR CTTCACTCTAAGATTGCTGA AGG (reversed) Intronic