ID: 1045414305

View in Genome Browser
Species Human (GRCh38)
Location 8:101951390-101951412
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045414303_1045414305 -8 Left 1045414303 8:101951375-101951397 CCTTCAGCAATCTTAGAGTGAAG No data
Right 1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type