ID: 1045415239

View in Genome Browser
Species Human (GRCh38)
Location 8:101959890-101959912
Sequence CCTAAGGTATTGAAGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045415239_1045415244 8 Left 1045415239 8:101959890-101959912 CCCTCAGGCTTCAATACCTTAGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1045415244 8:101959921-101959943 GACACCTCTTCATCCCACTTGGG No data
1045415239_1045415243 7 Left 1045415239 8:101959890-101959912 CCCTCAGGCTTCAATACCTTAGG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1045415243 8:101959920-101959942 AGACACCTCTTCATCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045415239 Original CRISPR CCTAAGGTATTGAAGCCTGA GGG (reversed) Intronic
902741163 1:18439403-18439425 GCCAGGATATTGAAGCCTGAGGG + Intergenic
903759200 1:25685919-25685941 CCTAAGGCTTTGGAGCCAGAGGG + Intronic
909604464 1:77494630-77494652 CCCAAGGAAGTGAAGCATGAAGG + Intronic
910655414 1:89613541-89613563 TCTAAGGTACTGAAGACTTAAGG - Intergenic
910803876 1:91171421-91171443 CCTAAGGTTTTGAAGGTAGAAGG + Intergenic
912424898 1:109578655-109578677 CTTAAGGTCTAGAAGCCTAATGG - Intronic
914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG + Intronic
917164447 1:172096764-172096786 CCAAAGGTATTGGAGACTCATGG + Intronic
920869307 1:209780505-209780527 CCTAACGAAGTGGAGCCTGAGGG + Exonic
1062936229 10:1392311-1392333 GCTGAAGTATTGTAGCCTGAGGG - Intronic
1065779274 10:29151617-29151639 ACTCAGGAATTAAAGCCTGAAGG + Intergenic
1065819406 10:29511238-29511260 CCTTAGGTGTGGAAGCCAGAAGG - Intronic
1065953441 10:30673176-30673198 CCTTAGGTGTGGAAGCCAGAAGG + Intergenic
1073585243 10:104703818-104703840 CCTCAGGTTTGGAACCCTGATGG - Intronic
1074453806 10:113580445-113580467 TCTAAGGTTTTGTAACCTGATGG + Intronic
1074545607 10:114399997-114400019 CCCAAGGAAATGAAGCCTGTGGG + Intronic
1081827374 11:46069571-46069593 TCCAAGGTAATGAAGCCTAAAGG + Intronic
1085898713 11:80670887-80670909 CTTAAGGTAATGAACCATGATGG + Intergenic
1085950895 11:81330086-81330108 GCTAAAGTATTCAAGCCAGAGGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1091081102 11:132669134-132669156 CCTAAGCTATTGGGGCCTGTGGG - Intronic
1091828308 12:3531737-3531759 CCCAAGGTCACGAAGCCTGAAGG + Intronic
1092519656 12:9255687-9255709 GTAAAGGTATTGAAGCATGAAGG + Intergenic
1096706402 12:53424909-53424931 CCAAGGGTACTGAAGCCTGATGG + Intronic
1099633479 12:85180427-85180449 CAGAAGGTATTGAAGCTTTAGGG - Intronic
1099963338 12:89418191-89418213 TTTAAGGCATTGATGCCTGAGGG + Intergenic
1107017403 13:35718778-35718800 CCCAAGGGACTGTAGCCTGAAGG + Intergenic
1118208044 14:63741569-63741591 GCAAAGATATTGAAGCCTGAAGG + Intergenic
1120476946 14:85000123-85000145 CCTTAGGTATTGTAGTGTGACGG - Intergenic
1122657224 14:103270182-103270204 CCTAAAGGGTTGCAGCCTGAAGG - Intergenic
1132215900 15:100061453-100061475 CCTCAGCTCCTGAAGCCTGAGGG - Intronic
1136561181 16:31040071-31040093 CCCCAGGCATTGAGGCCTGAAGG - Exonic
1137872205 16:51961148-51961170 CCTGAGGCATCTAAGCCTGATGG - Intergenic
1139907868 16:70379144-70379166 CCAAATGTATCGGAGCCTGATGG + Exonic
1140224842 16:73068829-73068851 CCTAAGGTAGGGAAGGCTGTGGG + Intergenic
1142470514 17:160966-160988 CCTGAGCCACTGAAGCCTGAGGG - Intronic
1146150656 17:30467111-30467133 CTTAAGGCATTGAAGCCATATGG + Exonic
1146700267 17:34952149-34952171 CCCTAGGTTTTGAATCCTGAAGG - Intronic
1146922146 17:36720862-36720884 CCTAAGCTCTTGGTGCCTGAGGG + Intergenic
1157444699 18:47736027-47736049 TCTAAGGTATTGAAGCTGAAAGG + Intergenic
1158580843 18:58681195-58681217 CTTAAGGTACTGGAGCCTGAAGG + Exonic
1160153962 18:76418874-76418896 GCAAAGGAATGGAAGCCTGAAGG + Intronic
1164437780 19:28246809-28246831 CAGCAGGTATTGAAGCCTCAGGG + Intergenic
1166800946 19:45456495-45456517 CCTAAGGGACTGAGGCCTAAGGG + Intronic
925793914 2:7522423-7522445 CCTGAGGTATTGCAGCGTAAAGG - Intergenic
927133639 2:20081056-20081078 TCAAAGGCATTGAAGCCTGTGGG + Intergenic
927253120 2:21016422-21016444 CCTAAGGTAAAGAAGGCCGAGGG - Exonic
927721465 2:25385617-25385639 CCTAAGGTCGTGCAGCTTGAAGG - Intronic
930307477 2:49693661-49693683 CCTAAGGTATTTAAACCTCCTGG + Intergenic
933223936 2:79723850-79723872 CCTAAGGGAATGAGGCCTGAAGG + Intronic
937825546 2:126365130-126365152 CCTGGGGTATGGAAACCTGATGG - Intergenic
938128173 2:128689515-128689537 CATAAGAAATTAAAGCCTGAGGG - Intergenic
942444654 2:176070082-176070104 CCTAAGGTCTGGAGGCCTGTGGG + Intergenic
1170396210 20:15928161-15928183 ACTAAAGTATTCAAGGCTGATGG + Intronic
1172735232 20:37121926-37121948 CTTAAATTATTGGAGCCTGATGG - Intronic
1175140868 20:56859541-56859563 CCTGAGGCAATGAAGCTTGAAGG - Intergenic
1177139520 21:17343231-17343253 TCCAAGGTACTGAATCCTGATGG - Intergenic
1179360973 21:40708531-40708553 ATTAAGGTACTGAAGCTTGAAGG + Exonic
956859495 3:73308371-73308393 ATTAAGGTAATGAAGCCTTATGG - Intergenic
960043704 3:113175805-113175827 CCTCGGGCATTGAGGCCTGAGGG - Intergenic
961626551 3:128268112-128268134 TCTCAGGTATTGAAACCTCATGG + Intronic
962435457 3:135362299-135362321 ACTAAGGTAGTGTAGGCTGAGGG + Intergenic
967921872 3:194619874-194619896 TACAAGGTATTGAAGCCTGAGGG - Intronic
968404370 4:327210-327232 ACTAAGCCATTTAAGCCTGAGGG + Intergenic
969122567 4:4920821-4920843 CTCAAGGTGTTGAAGGCTGAGGG - Intergenic
970635910 4:18009519-18009541 TCCAAGGTATTAGAGCCTGAGGG - Intronic
972581047 4:40395956-40395978 GCTTAGGTACTGAAGCATGACGG - Intergenic
979307524 4:119164336-119164358 CCTAAACTTTTCAAGCCTGAAGG + Exonic
979947160 4:126846545-126846567 TCTAAAGCATTGATGCCTGAAGG + Intergenic
980948875 4:139351564-139351586 CTTAAAGTATTGAAGACTGGTGG - Exonic
985817029 5:2134726-2134748 CCTGGGGTATGGAAGCCTGACGG + Intergenic
986079843 5:4378859-4378881 CCTAAGGTATTGAAACATGATGG + Intergenic
986683965 5:10259692-10259714 CCTCAGGGATTGAAGCATGCTGG + Intronic
989439349 5:41452053-41452075 CCCAAGGTATTGGTGCCAGAAGG + Intronic
990379993 5:55213614-55213636 CAATAGGTATGGAAGCCTGAAGG - Intergenic
991369118 5:65899967-65899989 ACTCAGGTTTTGAAGACTGAAGG + Intergenic
1013253947 6:108364456-108364478 CCTAAGGTTTAGAAAACTGAAGG - Intronic
1013761883 6:113528410-113528432 CCTAAGTAGTAGAAGCCTGAAGG + Intergenic
1014747083 6:125213329-125213351 CCTGGTGTATGGAAGCCTGAAGG + Intronic
1017050206 6:150384237-150384259 CCTAATATTTTGCAGCCTGATGG - Intronic
1019180598 6:170185394-170185416 CCGCAGGGACTGAAGCCTGAGGG - Intergenic
1020193998 7:6022995-6023017 CCTAAGGTTTTGGGGGCTGAGGG - Exonic
1024942812 7:54779959-54779981 CCTAAGGAATTGCAGGCTGCTGG - Intergenic
1030866856 7:114710703-114710725 CATGAGGTATGGAAGCCTGGAGG - Intergenic
1035062441 7:156079530-156079552 CATAAGGGATAGTAGCCTGAGGG - Intergenic
1036450248 8:8859973-8859995 CCTAAGGTATGCAGTCCTGATGG - Intronic
1037288440 8:17325355-17325377 GCAAAGGTTTTGAGGCCTGATGG - Intronic
1037305663 8:17500872-17500894 CTTAACTAATTGAAGCCTGATGG - Intronic
1039545655 8:38409215-38409237 CCAAAGGTATTTCAGCCTGTAGG + Intronic
1045415239 8:101959890-101959912 CCTAAGGTATTGAAGCCTGAGGG - Intronic
1046233361 8:111387526-111387548 TCTTAGGGATTGAAGGCTGAAGG + Intergenic
1051124090 9:13784187-13784209 CTCCAGGCATTGAAGCCTGAGGG - Intergenic
1056616840 9:88175762-88175784 GCAAAGGTATTGATGGCTGAAGG + Intergenic
1062069747 9:134549304-134549326 CAGAAGGTACTGAAGCCAGAAGG - Intergenic
1192340924 X:70262717-70262739 CCCAAGTTTTTGAAGCCAGACGG + Intergenic