ID: 1045415976

View in Genome Browser
Species Human (GRCh38)
Location 8:101967960-101967982
Sequence ATCTGGGTGTCACACTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045415976_1045415981 29 Left 1045415976 8:101967960-101967982 CCAGTGTAGTGTGACACCCAGAT 0: 1
1: 0
2: 1
3: 2
4: 58
Right 1045415981 8:101968012-101968034 AAAGAGAAACAGAATATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045415976 Original CRISPR ATCTGGGTGTCACACTACAC TGG (reversed) Intronic
902345323 1:15812564-15812586 GCCTGGGTGACACGCTACACTGG + Intergenic
1063100139 10:2943111-2943133 ATATGGGAGTCACACTACACCGG - Intergenic
1063411441 10:5839682-5839704 ATCTGGATGTCACGTTAGACTGG + Intronic
1065679618 10:28215374-28215396 ATCTGGCTGCTACCCTACACTGG - Intronic
1074699582 10:116081259-116081281 CTCAGGGTGTCAGACTCCACAGG - Intronic
1076946524 10:133655530-133655552 CTCTGGAAGTCACACTGCACTGG - Intergenic
1080302586 11:30800736-30800758 ATCAGGGTATCCCACTGCACTGG + Intergenic
1087122823 11:94592644-94592666 ATCTCAGTGTCACAATACCCAGG + Intronic
1099777473 12:87151635-87151657 ATCTGGCTTTCAGACTTCACAGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1115380144 14:32727565-32727587 ATCTGGAAATCACATTACACTGG - Intronic
1121393149 14:93593864-93593886 TTCTGGGTCACACAGTACACGGG + Intronic
1124146605 15:27133399-27133421 ATGGGGGTGTAACACCACACAGG - Intronic
1130160882 15:81398678-81398700 TTCTGGGTGTCACATTGCCCAGG - Intergenic
1133854396 16:9536149-9536171 ATCTGTGTCTCTCACTAGACTGG - Intergenic
1141350389 16:83289428-83289450 ATCTGGGTTCCACACTAAAGTGG - Intronic
1143474547 17:7195280-7195302 ATCTGGTTGTCACACTTCCAGGG - Intronic
1145986106 17:29047560-29047582 ATCTTGCTTTCACACTACAATGG - Intronic
1146804354 17:35853386-35853408 TTCTGAGTGACACACTATACAGG + Intronic
926002017 2:9340885-9340907 GTCTGGGTGTCACAGGACAGAGG + Intronic
931038097 2:58265664-58265686 ATCCTGCTGTAACACTACACAGG + Intergenic
935335704 2:102013981-102014003 ATGGGGGTGCCACACTACATGGG + Intronic
935732021 2:106072391-106072413 GTCTGGGGGTCACAACACACAGG + Intronic
941279518 2:163532796-163532818 ATCTGGAAGTCACACTACTTAGG + Intergenic
947207113 2:227671920-227671942 AACTGGGTGTGACAGTAAACAGG + Intergenic
947603195 2:231467367-231467389 AAGTGGGTGCCTCACTACACAGG - Intronic
948666623 2:239538754-239538776 ACCTGGGGGTCTCACTACCCAGG - Intergenic
1175076799 20:56382201-56382223 GTCTGGGTGTCAAACTACTGTGG - Intronic
1179022265 21:37651171-37651193 TTCTCGATGTCACACTACAGGGG + Intronic
1184420707 22:44381404-44381426 ATCTGGGTGTCCCCAAACACTGG + Intergenic
956593251 3:70939140-70939162 ATCTGGGTGCCTTACTGCACTGG + Intergenic
959261476 3:104087739-104087761 ATCTGGGATTCACACTGCTCTGG - Intergenic
961369281 3:126419628-126419650 ATCTGGAGATCTCACTACACCGG - Exonic
965439503 3:168695519-168695541 ATCTGGGGGCAACACTACAAAGG + Intergenic
974463516 4:62222101-62222123 ATTTGGGTGTCAGACAACATAGG - Intergenic
985449942 4:190056189-190056211 CTCTGGAAGTCACACTGCACTGG - Intergenic
986710511 5:10485228-10485250 ATGTGGTGGTCACACGACACAGG - Intergenic
997287582 5:132692496-132692518 TTCTGGGTGTGAAACTACACAGG + Intergenic
998873268 5:146574183-146574205 ATCTGGGAGTCAAATGACACGGG + Intergenic
1000709376 5:164552278-164552300 ATCTGGGATTCACACTAAATGGG - Intergenic
1010393165 6:75359801-75359823 TTCTGGGTCTCAAATTACACAGG + Intronic
1014738701 6:125124025-125124047 ATCAGGGGGTAAAACTACACAGG + Intronic
1021792714 7:24222376-24222398 ATCTGGGAGTAAGACTGCACTGG - Intergenic
1021998689 7:26203801-26203823 CTCTGGGTTTCACACTAAAAAGG + Intronic
1022568537 7:31428169-31428191 ATCAGGGTTTGACACGACACAGG - Intergenic
1029098864 7:98111267-98111289 ATCTAAGTGACACAATACACAGG - Intronic
1029421359 7:100473332-100473354 ATCAGGATGTCACGCTCCACAGG + Intronic
1033112866 7:138597883-138597905 ATCCGGGTCTCACACCACCCAGG - Intronic
1034231862 7:149536092-149536114 ATCTGGATGTGAGATTACACAGG + Intergenic
1036757581 8:11481423-11481445 GTCTGGGTGTCACTCCTCACTGG + Intergenic
1042954204 8:74231107-74231129 ATCTGCTTGTCAAACTTCACTGG + Intergenic
1043630809 8:82330004-82330026 ATATGGGTGTCACAAGTCACAGG - Intergenic
1044724382 8:95181223-95181245 ATTTTGGTGTCACACTCCAGAGG - Intergenic
1045283676 8:100771754-100771776 TTCTGGCTGTCACACTAACCGGG - Intergenic
1045415976 8:101967960-101967982 ATCTGGGTGTCACACTACACTGG - Intronic
1049385044 8:142338900-142338922 ATCTGGGAGCCACCATACACTGG + Intronic
1052856116 9:33407748-33407770 ACCGGGCAGTCACACTACACTGG - Intergenic
1058263770 9:102872461-102872483 ATCTGGGTCTCAGATTACACAGG + Intergenic
1060632240 9:125169468-125169490 AACTGGGGGAAACACTACACTGG + Intronic
1186817349 X:13251032-13251054 ATCTGGTGGTCACACTAGAAAGG + Intergenic
1190304930 X:49076525-49076547 CTGTGGGTATCACACAACACAGG + Intronic
1193478038 X:81991197-81991219 ATATGGGTGTGACACTATTCGGG + Intergenic