ID: 1045418342

View in Genome Browser
Species Human (GRCh38)
Location 8:101989363-101989385
Sequence GCACTACTAATTCATCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045418339_1045418342 3 Left 1045418339 8:101989337-101989359 CCACAAAATTGTTTCTCACCCTT 0: 1
1: 0
2: 4
3: 39
4: 331
Right 1045418342 8:101989363-101989385 GCACTACTAATTCATCCTAAAGG No data
1045418338_1045418342 9 Left 1045418338 8:101989331-101989353 CCAGAGCCACAAAATTGTTTCTC 0: 1
1: 0
2: 2
3: 13
4: 188
Right 1045418342 8:101989363-101989385 GCACTACTAATTCATCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045418342 Original CRISPR GCACTACTAATTCATCCTAA AGG Intronic
No off target data available for this crispr