ID: 1045420242

View in Genome Browser
Species Human (GRCh38)
Location 8:102007414-102007436
Sequence ATGTATCAACTGATGAAATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045420242_1045420244 -6 Left 1045420242 8:102007414-102007436 CCGAATTTCATCAGTTGATACAT 0: 1
1: 0
2: 2
3: 29
4: 305
Right 1045420244 8:102007431-102007453 ATACATAAGCATGTGGCTTGAGG No data
1045420242_1045420246 24 Left 1045420242 8:102007414-102007436 CCGAATTTCATCAGTTGATACAT 0: 1
1: 0
2: 2
3: 29
4: 305
Right 1045420246 8:102007461-102007483 CTTGAAAAGTACAGCTCTAAAGG No data
1045420242_1045420247 30 Left 1045420242 8:102007414-102007436 CCGAATTTCATCAGTTGATACAT 0: 1
1: 0
2: 2
3: 29
4: 305
Right 1045420247 8:102007467-102007489 AAGTACAGCTCTAAAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045420242 Original CRISPR ATGTATCAACTGATGAAATT CGG (reversed) Intronic
902111218 1:14080048-14080070 AGGTCTCAACAGATGAATTTTGG + Intergenic
908004663 1:59715422-59715444 ACCTATCAATTGATTAAATTGGG - Intronic
909312616 1:74172647-74172669 ATCTATCAATTGTTGAAAGTGGG + Intronic
909677952 1:78258295-78258317 ATGGATGAACTGATGGAAGTAGG + Intergenic
910346668 1:86246798-86246820 ATATACCAGCTGATGAAACTGGG + Intergenic
911538970 1:99135532-99135554 ATGTATAAAATGATGAAAGCTGG + Intergenic
913031651 1:114911149-114911171 ATATATTAATTGATGAAATCAGG - Intronic
913667517 1:121062103-121062125 GTGTATTAACTGAGGAAACTGGG - Intergenic
914019208 1:143849246-143849268 ATGTATTAACTGAGGAAACTGGG - Intergenic
914657759 1:149757453-149757475 GTGTATTAACTGAGGAAACTGGG - Intergenic
914721088 1:150289643-150289665 ATGTATCAAATGAGGAGGTTGGG - Intergenic
915858782 1:159419899-159419921 ATCTATCTAATGATGAAAGTAGG + Intergenic
919345937 1:196378420-196378442 ATGTGTCATTTGATGAAACTTGG + Intronic
919461867 1:197886126-197886148 ATGTTTCAACATATGAATTTGGG + Intergenic
921666170 1:217874473-217874495 ATTTATAAAGTGATGAAATCAGG + Intergenic
923179394 1:231501393-231501415 AGGTTTCAACTTATGAATTTTGG + Intergenic
923214527 1:231836201-231836223 ATGGATCAACTTAAGAAAATGGG - Intronic
923697257 1:236265504-236265526 ATGTAGAAAATGATCAAATTAGG - Intronic
924203464 1:241685351-241685373 ATCTTTCAACAGATGAATTTGGG + Intronic
924238401 1:242018525-242018547 ATGTATCAACTTATCAAAAATGG - Intergenic
924837232 1:247663181-247663203 ATCTATTAATTGATGAAAGTGGG + Intergenic
1063079989 10:2758254-2758276 ATATATTAAATGAGGAAATTAGG - Intergenic
1063818166 10:9801218-9801240 ATCTATCCACTGTTGAAAGTGGG + Intergenic
1064277696 10:13921671-13921693 AGGTTTCAACAGATGAATTTTGG + Intronic
1064434155 10:15296143-15296165 CTGTGTAATCTGATGAAATTAGG + Intronic
1065406040 10:25366317-25366339 ATGTATAAATTGATGTAATCTGG - Intronic
1066475388 10:35741842-35741864 ATTTTCCAAATGATGAAATTGGG + Intergenic
1068229234 10:54149568-54149590 ATGTATAAACTGTTGACATGAGG + Intronic
1068328125 10:55522389-55522411 ATCTATCCATTGATGAAAGTGGG + Intronic
1070103033 10:73406330-73406352 AGGCATCAAGTGATGAAACTTGG - Intronic
1071239407 10:83687749-83687771 AAACATCAAGTGATGAAATTAGG - Intergenic
1071313090 10:84362432-84362454 CTGTACCAACTGGTAAAATTTGG + Intronic
1072379389 10:94851841-94851863 ATGTTTCAACATATGAAATGGGG + Intronic
1072391110 10:94987924-94987946 ATGTGTCAACATATGAAATTGGG + Intronic
1072596412 10:96876392-96876414 ATTTCTCAACACATGAAATTTGG + Intronic
1074616703 10:115076858-115076880 ATCTATCAACTGATCACATTTGG + Intergenic
1074681468 10:115911645-115911667 TTGCCTCAACTGATGAAATCGGG - Intronic
1074988268 10:118677308-118677330 AAGTATAAACAGATGAAAATAGG - Exonic
1076063607 10:127431241-127431263 TTGTTTCATCTGATGCAATTAGG - Intronic
1079575175 11:21995270-21995292 TTTAATCAACTGATGAAGTTGGG + Intergenic
1079819633 11:25109004-25109026 ATCTATTGACTTATGAAATTTGG + Intergenic
1080528588 11:33151591-33151613 ATGTATCAGCCGATGGACTTTGG + Intronic
1080969351 11:37252141-37252163 ATGTATCAACAAATGACATATGG + Intergenic
1081306889 11:41523315-41523337 ATGTATCAGTTGAAGAAACTGGG - Intergenic
1081844385 11:46228834-46228856 ATTTATCAACTGATGGACATCGG - Intergenic
1083502272 11:63120660-63120682 TAGTATCAACTCATGTAATTTGG - Intronic
1084927348 11:72524098-72524120 ATCTTTCAAATGAGGAAATTGGG - Intergenic
1085368028 11:75970794-75970816 ATGTTTTAACAGAAGAAATTGGG - Intronic
1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG + Intronic
1086583670 11:88427634-88427656 ATCTCTCAACTCATGAACTTTGG - Intergenic
1086946286 11:92846931-92846953 ATGTATCACCTGCTGAAGATAGG - Intronic
1087700095 11:101426973-101426995 ATCTATCTACTGTTGAAAGTGGG + Intergenic
1088096891 11:106111553-106111575 AAGCATAATCTGATGAAATTCGG + Intergenic
1088594430 11:111429415-111429437 ACGTAGCAACTGATGAAATCAGG + Intronic
1090911006 11:131119446-131119468 ATTTATCCACTGTTGAAATGAGG + Intergenic
1091592676 12:1854272-1854294 TTGTAACATCTGATGAACTTAGG + Intronic
1093067906 12:14677936-14677958 ATGTTTGAACTGCTGCAATTAGG + Intronic
1093950454 12:25160183-25160205 TTATATTTACTGATGAAATTAGG - Intronic
1094726334 12:33120919-33120941 ATCTGTCAAATGCTGAAATTGGG + Intergenic
1095264219 12:40134716-40134738 ATTTATTTATTGATGAAATTGGG + Intergenic
1095367291 12:41422807-41422829 ATGTATATATTTATGAAATTTGG - Intronic
1095836255 12:46642284-46642306 ATTTATCAGCTGAAGGAATTTGG - Intergenic
1095914435 12:47462340-47462362 ATGGATCAACCAATGAAATGAGG + Intergenic
1097501328 12:60407849-60407871 ATGTAACATCTGAAGAAAGTAGG + Intergenic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1099114020 12:78601692-78601714 ATTTACTAACTGATTAAATTAGG - Intergenic
1099564904 12:84230602-84230624 ATGTGTCAAGTCTTGAAATTAGG + Intergenic
1100153193 12:91766768-91766790 ATGAATGAACTGAAGCAATTAGG + Intergenic
1101213579 12:102559303-102559325 ATGTAGCAATTGATTAAATGGGG - Intergenic
1101288183 12:103337917-103337939 AAGTATCAAGGGATGAAATGAGG - Intronic
1104556811 12:129807553-129807575 ATGTATAAACTGCTTATATTTGG + Intronic
1106664206 13:31834691-31834713 ATGTATCAAATTATAAAATGGGG + Intergenic
1107131187 13:36897800-36897822 ATGTTTCCACTAATGAACTTTGG - Intronic
1109297727 13:60554973-60554995 ATGTATCATCTGATTCAACTAGG - Intronic
1109777508 13:67061215-67061237 ATCTCTCAACTGCTTAAATTAGG - Intronic
1110623945 13:77630419-77630441 ATTCATCACCTGATGACATTTGG + Intronic
1111440004 13:88269257-88269279 ATATATCAACTTTTAAAATTTGG - Intergenic
1112069537 13:95834002-95834024 ATGAATCAACTGAAAATATTTGG - Intronic
1112742742 13:102493838-102493860 ATGTTTCAACATATGAATTTTGG - Intergenic
1112954712 13:105043301-105043323 AGGAATAAACTGATGACATTGGG - Intergenic
1115556967 14:34551527-34551549 ATCTATCACCAGATGAAAATTGG - Intergenic
1117559384 14:56921175-56921197 ATTTCTCAACACATGAAATTTGG - Intergenic
1117782340 14:59246444-59246466 ATTTATCTATTGATGACATTTGG + Intronic
1117879396 14:60296284-60296306 CTGAAAGAACTGATGAAATTGGG + Intronic
1118433026 14:65741087-65741109 ATGTATAAATTGCTTAAATTGGG + Intronic
1118659665 14:67994865-67994887 ATTCATCTACTGATGACATTTGG - Intronic
1119792308 14:77363042-77363064 ATGTATCCATTGTTGAAAATGGG - Intronic
1121158687 14:91713337-91713359 GAGTGACAACTGATGAAATTAGG + Intronic
1123188958 14:106549620-106549642 ATGAATCAACAGATAAAATGTGG + Intergenic
1124455278 15:29836660-29836682 AAGTTTCAACTCATGAATTTGGG - Intronic
1125848136 15:42877463-42877485 ATTTATTTACTGAAGAAATTAGG - Intronic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127600123 15:60527296-60527318 CTGTATCTCATGATGAAATTAGG + Intronic
1128301600 15:66569620-66569642 AAGTTTCAACATATGAAATTCGG - Intergenic
1128405512 15:67333525-67333547 ATGGATCACCTGATGATATTTGG + Intronic
1128406816 15:67350134-67350156 ATGTCTCAGCTGATGAATTGAGG + Intronic
1128833528 15:70790759-70790781 ATGTTTCAACTGATGGCAATTGG + Intergenic
1129369682 15:75083113-75083135 ATTCATCAACTGATGAACATTGG - Intronic
1129790421 15:78337423-78337445 ATGTGCCACCTGATGAGATTTGG + Intergenic
1130394749 15:83492397-83492419 ATGTATTTACTGAAGAAATGTGG - Intronic
1132649989 16:1016266-1016288 GTGTATCAACTGGTGACCTTGGG + Intergenic
1133786697 16:8979455-8979477 ATGTATCAACTAAGCAACTTGGG - Intergenic
1135282079 16:21160476-21160498 ATGTATGGAATGATGGAATTGGG + Intronic
1137001146 16:35232195-35232217 ATGAGTCAACTGATAAAAGTGGG - Intergenic
1137031717 16:35530946-35530968 ATGAGTCAACTGATAAAAGTGGG - Intergenic
1137815982 16:51397790-51397812 ATGTTCCAACAGATGAATTTTGG + Intergenic
1137888004 16:52127172-52127194 ATGTATTAAGTGCTGAAATGAGG + Intergenic
1139089305 16:63624972-63624994 ATTTTTCAACTGAAGAGATTGGG - Intergenic
1146014253 17:29219781-29219803 TTGTATCCACGGATGAAAATAGG - Intergenic
1150162667 17:62912343-62912365 ATGTTTCAACACATGAACTTCGG - Intergenic
1150602989 17:66666641-66666663 ATATAACATCTGTTGAAATTTGG - Intronic
1150987700 17:70217125-70217147 ATGTATTAGCTGATGAAACACGG - Intergenic
1151103784 17:71588272-71588294 ATGTCTGAACTGATGACTTTTGG - Intergenic
1153386582 18:4504599-4504621 ATGTATTCACTGCTGAAAATGGG - Intergenic
1153906134 18:9662852-9662874 AAGTTTCAACTTATGAATTTTGG + Intergenic
1154367889 18:13727461-13727483 ATGTATCAATTTAACAAATTGGG - Intronic
1155913800 18:31535993-31536015 ATTTATCTACTGGAGAAATTAGG - Intronic
1156071994 18:33222640-33222662 ATGTTTCAACATATGAATTTTGG + Intronic
1156893553 18:42217050-42217072 ATGCATCAAATCATGAGATTGGG - Intergenic
1158388627 18:57023636-57023658 ATCTATCAAATGATGTAATTTGG + Intronic
1159128625 18:64254595-64254617 ATTTTACAAATGATGAAATTGGG - Intergenic
1159460582 18:68717839-68717861 AAGTTTCAACATATGAAATTTGG - Intronic
1160144927 18:76356060-76356082 AGGTTTCAACGTATGAAATTCGG - Intergenic
1162361391 19:10222681-10222703 AAGTGGCAGCTGATGAAATTTGG + Intronic
1164943771 19:32272710-32272732 AATTATCAATTGATAAAATTTGG + Intergenic
1167924830 19:52813010-52813032 ATGTATAAATTGCTTAAATTGGG - Intronic
1168263835 19:55210297-55210319 ATTTATCAACTGTTTAAAATGGG - Intergenic
1168662346 19:58177238-58177260 TTGTATCTAGTGATGAATTTGGG + Intergenic
925424584 2:3738148-3738170 ACATTTGAACTGATGAAATTTGG + Intronic
925645017 2:6027107-6027129 ATGAATCAAGTGATAAAAATGGG - Intergenic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
926925397 2:17982117-17982139 ATTTAGCCACTGATGAAATCGGG - Intronic
929674557 2:43912814-43912836 ATGTATCAACTTAAGAAAGCTGG - Intronic
929783827 2:44975005-44975027 AGGTTTCAACAGATGAAATTGGG - Intergenic
929846421 2:45533733-45533755 ATGTAGCAATTGATGAACTTTGG - Intronic
930337254 2:50064734-50064756 ATGTATTTATTGATGAACTTTGG - Intronic
930740001 2:54822576-54822598 ATGTTTTAAATGATGATATTGGG + Intronic
932170159 2:69547832-69547854 ATTTATCAGTTGATGGAATTGGG - Intronic
932933615 2:76074968-76074990 ATGTATGAATTGATAAAATCTGG + Intergenic
933472405 2:82742732-82742754 ATTCTTCAACTGATGAATTTTGG - Intergenic
933793354 2:85901390-85901412 ATGTATGTAAAGATGAAATTTGG - Intergenic
936725799 2:115313447-115313469 ATATAGCAACAGATGAAATATGG + Intronic
937742351 2:125370539-125370561 ATTTATAAAATGATGAGATTGGG - Intergenic
937966746 2:127517814-127517836 ATTCATCAGCTGATGACATTTGG - Intronic
939173812 2:138726581-138726603 TTGACTCAACTGATAAAATTTGG - Intronic
940260594 2:151775927-151775949 ATGTTTCAACATATGAATTTGGG - Intergenic
940681227 2:156787549-156787571 ATGTATTAACTGAAGTAATCGGG + Intergenic
941789276 2:169533830-169533852 ATGTTTCAACAGATGAATTTTGG - Intronic
943009339 2:182427569-182427591 ATATATTATGTGATGAAATTTGG + Intronic
945164446 2:206927550-206927572 ATGGATGAACTGATTAAAGTGGG + Intergenic
945622746 2:212161905-212161927 ATTTATGAACTGATGAAAAATGG - Intronic
1168949731 20:1788806-1788828 ATGTATCAAATTATGAGAATAGG + Intergenic
1169617668 20:7468308-7468330 ATCTATCCAATGATGAAAGTGGG + Intergenic
1169697203 20:8403440-8403462 ATGTAGTAAATGATGTAATTGGG + Intronic
1173170991 20:40723719-40723741 ATTTGTCAAATGATGAATTTAGG - Intergenic
1174900557 20:54495097-54495119 ATGAATCTACTGAGGAGATTGGG - Intronic
1175365340 20:58450520-58450542 ATTTATCAACTGCTGCCATTTGG + Exonic
1176985169 21:15427587-15427609 GTCCATCAACTGATGAAAATAGG - Intergenic
1177500846 21:21952625-21952647 ATGCTTCAACTGAAGAAATGGGG - Intergenic
1177530243 21:22349536-22349558 AAGTTTCAACATATGAAATTTGG - Intergenic
1177733233 21:25056359-25056381 ATGTTTCAAGTGATAAAATTGGG + Intergenic
1177760484 21:25397529-25397551 ATGTATCTTCTGATGGGATTTGG + Intergenic
1178165014 21:29963967-29963989 ATGTTTCAACAAATGAATTTGGG - Intergenic
1178194248 21:30324908-30324930 ATGTATCCACTGTTGAAACCGGG + Intergenic
1179019135 21:37622436-37622458 TTGTGTCAACTGTTAAAATTTGG - Exonic
1179066430 21:38028841-38028863 ATTTATAAACTGATGAGTTTGGG + Intronic
1179112688 21:38461044-38461066 ATGTATCGAATATTGAAATTGGG - Intronic
1183811159 22:40258812-40258834 CTGTTTCAACTGAAGAAATTTGG - Intronic
1184627451 22:45747682-45747704 ATCTATTAACTGTTTAAATTTGG + Intronic
949656838 3:6230677-6230699 ATGTACCAGCTTATGAACTTTGG - Intergenic
951470973 3:23055610-23055632 AGGTTTCAACAGATGAATTTTGG + Intergenic
951852612 3:27159073-27159095 ATATACCTACTAATGAAATTAGG - Intronic
954032126 3:47827058-47827080 ATGTATGAAATGAGGAGATTGGG + Intronic
956057492 3:65315654-65315676 AGGTATTAACTTATGAACTTTGG + Intergenic
956326388 3:68057275-68057297 CTGTTTCAAGTGATGAGATTCGG - Intronic
957480134 3:80781952-80781974 ATTTATCAATTGATGAGTTTTGG + Intergenic
959019538 3:101173324-101173346 AGGTATCAATACATGAAATTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960486300 3:118257243-118257265 TTGTAGCAAGTGTTGAAATTGGG - Intergenic
960636536 3:119790300-119790322 ATTCATCAGTTGATGAAATTTGG + Intronic
963462130 3:145628780-145628802 CTGTATCATTTGATGAACTTTGG + Intergenic
964982036 3:162696568-162696590 ACGTTTCAACACATGAAATTTGG - Intergenic
966017878 3:175165523-175165545 GTGTATCAAATCTTGAAATTTGG + Intronic
966280913 3:178227370-178227392 TTGTATCACCTGCAGAAATTAGG - Intergenic
967147743 3:186620482-186620504 ATGTATAATGTGAGGAAATTGGG + Intronic
967368147 3:188711390-188711412 ATGTATTAGCTGTTGACATTAGG - Intronic
970114415 4:12677797-12677819 ATGTAACAATTAATGAAATATGG + Intergenic
970668351 4:18364777-18364799 ATGAATCAATAGATCAAATTGGG + Intergenic
970741289 4:19240947-19240969 ATGTATCAAATGATGAGGGTAGG + Intergenic
970754179 4:19404178-19404200 AAGGATCCACTGATGATATTAGG - Intergenic
970938254 4:21600431-21600453 ATGTATAAATTGGTGTAATTGGG + Intronic
970968915 4:21958966-21958988 CCATATCAACTGATGACATTCGG - Intergenic
970973050 4:22007470-22007492 ATGTATCAAATCATAAAATTAGG - Intergenic
971599597 4:28575457-28575479 ATGTTTCAACATATGAATTTGGG + Intergenic
971667083 4:29501640-29501662 ATATAACCACTGTTGAAATTTGG + Intergenic
971866054 4:32173770-32173792 ATTTATCATCTGATAAGATTTGG - Intergenic
972074806 4:35073585-35073607 ATGGATCAGTTGATGACATTGGG + Intergenic
972834708 4:42855850-42855872 ATTCATAAACTGAAGAAATTAGG + Intergenic
973024255 4:45247845-45247867 ATGTTTCAACACATGAATTTTGG - Intergenic
974057669 4:57000481-57000503 AAGTAACAACTGTTGAATTTGGG - Intronic
975504177 4:75120011-75120033 ATATATCAAATGCTGAAAGTGGG - Intergenic
977020698 4:91755593-91755615 GAGTATCAACAGATGAATTTGGG - Intergenic
977392389 4:96428294-96428316 ATGAATTATATGATGAAATTTGG - Intergenic
977401567 4:96539190-96539212 ATGTTTCAACATATGAATTTTGG - Intergenic
977725381 4:100290686-100290708 ATTTATCAAATGATTAAATAAGG + Intergenic
978115128 4:105010552-105010574 ATGTATATACTGTTGAATTTGGG + Intergenic
978506756 4:109466109-109466131 ACGTATCAACTGAGAAAGTTTGG - Intronic
978869600 4:113559238-113559260 ATGTATTAACTATTGGAATTCGG + Intronic
978963971 4:114719268-114719290 ATATTTCAACATATGAAATTTGG + Intergenic
979786380 4:124719998-124720020 ACGTATCAACTCATTAAATTTGG - Intergenic
980712972 4:136594303-136594325 ATATATCCAGTGATGAAAATGGG - Intergenic
981488608 4:145315524-145315546 ATGGAGCAACTGAAGAAACTGGG + Intergenic
982592819 4:157336660-157336682 GTGAATCAACTAATGAATTTGGG + Exonic
983801297 4:171932777-171932799 ATGTATAAAATAAGGAAATTGGG - Intronic
984462209 4:180052712-180052734 AGGTTTCAACTTATGAATTTGGG - Intergenic
984670133 4:182474000-182474022 ATGTATCTCCTGATGAGATGAGG + Intronic
985246181 4:187981971-187981993 GTGTATAAACAGATGAAATATGG + Intergenic
985482221 5:120771-120793 ATTTATGAACTGATAAAATCTGG - Intergenic
987778181 5:22396596-22396618 ATGGATCAAATGAGCAAATTTGG + Intronic
988933199 5:36057238-36057260 ATGTTTCAATTCATTAAATTGGG + Intronic
989753773 5:44926157-44926179 AGGTTTCAACATATGAAATTGGG + Intergenic
991332520 5:65507267-65507289 ATGTATCTTCTGAGGAACTTTGG - Intergenic
991357535 5:65784661-65784683 ATGTTTCAACACATGAATTTTGG + Intronic
992911552 5:81400610-81400632 AGGTTTCAACAGATGAATTTTGG - Intergenic
993226519 5:85172350-85172372 ATGACTCAACTGATGAAATCAGG + Intergenic
993334087 5:86635166-86635188 ATGTTTCAACATATGAATTTGGG + Intergenic
994334141 5:98544583-98544605 ATGCATAAACTGATGAAATAAGG + Intergenic
994572564 5:101532952-101532974 ATGAAAAAATTGATGAAATTAGG + Intergenic
994729944 5:103480338-103480360 AGGTTTCAACAAATGAAATTGGG - Intergenic
995537047 5:113147061-113147083 ATTTAGCACCAGATGAAATTTGG - Intronic
996635980 5:125690894-125690916 AAGTATCCAGTGATGAGATTTGG + Intergenic
996649746 5:125860788-125860810 ATCTCTCAACTGATTAAAATTGG + Intergenic
996669881 5:126105138-126105160 ATGCATCAACTCATAAAACTTGG + Intergenic
997876733 5:137555997-137556019 ATTTATCCAATGATGAAATTTGG + Intronic
998268858 5:140688722-140688744 ATTTATTAACTGAGGAAATTGGG + Intronic
998690104 5:144578657-144578679 ATGTATCAATTTATCAATTTAGG + Intergenic
999197052 5:149789256-149789278 ATGAATCAACTGAACAAATGAGG + Intronic
999382431 5:151131003-151131025 ATGAGTCAACAGATGAACTTAGG - Intronic
1001761667 5:174212862-174212884 ATGTATCAGTTGATGGATTTGGG + Intronic
1003894885 6:10598075-10598097 ATGTGTAAAATGAGGAAATTGGG + Intronic
1004212615 6:13666242-13666264 ACGGATCAACTGATGAAAAGAGG + Intronic
1004458128 6:15810692-15810714 ACATATCAACTTATAAAATTGGG - Intergenic
1004832674 6:19494510-19494532 ATGTATCAAATGCTGCATTTGGG + Intergenic
1005567050 6:27106713-27106735 ATTTATCATCTGATGACCTTGGG - Intergenic
1006692549 6:35901945-35901967 ATGTAACACCTGATAAACTTAGG - Intronic
1008151005 6:47950926-47950948 ATGTGTCAATTGATGGAATTTGG + Intronic
1008661151 6:53669477-53669499 ATATTTCAAGTGATGAAACTTGG + Intergenic
1008824182 6:55671734-55671756 TTGTATAAGCTGCTGAAATTTGG + Intergenic
1009741405 6:67751541-67751563 ACGTATCATCTGATTAGATTTGG - Intergenic
1011707078 6:90012242-90012264 CTGAATCTACTGATGAATTTAGG + Intronic
1011902538 6:92317673-92317695 ATGTAGCTACTAAAGAAATTAGG + Intergenic
1012379033 6:98598228-98598250 ATGTATCACCCTATGAATTTGGG + Intergenic
1013386479 6:109636783-109636805 ATGGATGAACTGATAAAATGTGG - Intronic
1013739047 6:113261936-113261958 ATTTATCAACTTATAAAACTAGG - Intergenic
1013839168 6:114369691-114369713 TTGTATGAACTCATGAAATATGG + Intergenic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1014365386 6:120534163-120534185 ATCTATCCACTGTTGAAAGTGGG - Intergenic
1014665105 6:124228160-124228182 AGGTTTCAACTTATGAATTTGGG - Intronic
1014977742 6:127909832-127909854 ATGTATCAAGTGAACAAAGTAGG - Intronic
1015507497 6:134004539-134004561 ATATATGAAATGAAGAAATTAGG + Intronic
1016577649 6:145587880-145587902 ATAACTCAACTGATGAGATTTGG + Intronic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1016741034 6:147528709-147528731 ATCTAACAGCTGATGAAACTAGG + Intronic
1017643823 6:156520000-156520022 ATTTATAAAATGATGAAATTAGG + Intergenic
1020461076 7:8430824-8430846 ATGTACAAAGTGATGTAATTTGG + Intergenic
1020913002 7:14156888-14156910 ATGTACCAACTGATCAAATTTGG + Intronic
1020920547 7:14258459-14258481 ATTTATAAACAGCTGAAATTAGG + Intronic
1021029399 7:15711640-15711662 ATGAATGACCTAATGAAATTAGG - Intergenic
1021261096 7:18458589-18458611 GTGTTTTAACTGATGAATTTTGG + Intronic
1021396393 7:20153922-20153944 ATGAATTAATTGATCAAATTGGG - Intronic
1023234640 7:38071778-38071800 ATAGATCAACTGATGAAAAAGGG + Intergenic
1025622676 7:63188426-63188448 ATGGAACAATTGAGGAAATTTGG - Intergenic
1026516784 7:71079632-71079654 ATTTATCCACTGATGACACTTGG - Intergenic
1027377996 7:77573533-77573555 ATGTTTTAACTTATGAATTTGGG + Intronic
1027721357 7:81745794-81745816 ATGTATAAGCTAATGTAATTAGG + Intronic
1027829917 7:83163823-83163845 ATGTCTCAACTGTTGAGGTTAGG + Intergenic
1028175362 7:87650569-87650591 AGGTATCAACATATGAATTTTGG + Intronic
1028626017 7:92878109-92878131 ATGTGTCCATTGTTGAAATTGGG - Intergenic
1031439295 7:121773422-121773444 ATACTTCAACTTATGAAATTTGG - Intergenic
1031814858 7:126421192-126421214 ATGTAACAACTGATCTCATTGGG - Intergenic
1033490167 7:141835516-141835538 AGGTTTCAACTTATGAATTTTGG + Intergenic
1033668930 7:143471305-143471327 AACTATCCACTGATGAAAATAGG + Intergenic
1033895663 7:146066270-146066292 TTGTACCAACTGTTTAAATTTGG - Intergenic
1036060588 8:5314594-5314616 ATGAAGCAACAGATGAAACTGGG + Intergenic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1036795011 8:11749483-11749505 ATTTATCAACTGATCAACTGAGG - Intronic
1037471339 8:19214485-19214507 AAATATCAAATGATAAAATTCGG - Intergenic
1037872066 8:22507567-22507589 ATTTAAAAACTGAGGAAATTAGG - Intronic
1038469138 8:27797160-27797182 ATGTATCCATTGTTGAAAGTAGG + Intronic
1039161385 8:34625662-34625684 ATGTATAAACTGCTAAAAATAGG + Intergenic
1039523860 8:38196072-38196094 ATCTATCAATTGATGAAATTTGG - Intronic
1042202973 8:66299696-66299718 AGGTTTCAACTTATGAATTTGGG - Intergenic
1042425552 8:68643749-68643771 ATGTTTCAACATATGAATTTGGG + Intronic
1043099688 8:76026641-76026663 ATTTCACAACTGAGGAAATTCGG - Intergenic
1043653921 8:82636822-82636844 TTGTATCAACTTATGGAAATTGG - Intergenic
1044214317 8:89590309-89590331 AGGTATTAACTCATGAAATATGG - Intergenic
1044446271 8:92280478-92280500 TTGTATCAATTGATGCAATTGGG - Intergenic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1046153585 8:110258543-110258565 ATGTAACAACTCATATAATTAGG + Intergenic
1046281474 8:112038728-112038750 ATGTTCCAAATGATTAAATTTGG - Intergenic
1046485618 8:114883896-114883918 ATGTGCCAACTGAAGAAATCAGG + Intergenic
1046715773 8:117564984-117565006 ATGCATAAAATGATCAAATTAGG - Intergenic
1048834175 8:138502540-138502562 TTTTATTAACTGATGAAATGAGG + Intergenic
1049135453 8:140894047-140894069 TGGTATCAACTTATGAATTTTGG - Intronic
1049590251 8:143456047-143456069 ATGTTCCAAATGATGGAATTGGG + Intronic
1050060232 9:1701135-1701157 ATGTATCAACACCTGAATTTTGG - Intergenic
1051323308 9:15934752-15934774 ATTCATCAACTGATGGACTTTGG - Intronic
1051696444 9:19772946-19772968 ATTCACCAACTGATGAAATGTGG + Intronic
1054736867 9:68762036-68762058 AGGAATCAACTGAAAAAATTAGG + Intronic
1055176948 9:73331188-73331210 ATCTATCCATTGCTGAAATTGGG + Intergenic
1055312011 9:74992470-74992492 ATGTATCCACTGATAAATTTGGG - Intronic
1055370536 9:75593633-75593655 ATGTTTCAACATATGAATTTGGG - Intergenic
1057448100 9:95133118-95133140 ATGAATCAGATGATGCAATTAGG + Intronic
1058280730 9:103110209-103110231 ATGTATTAATTAATGAAATATGG + Intergenic
1058416537 9:104794590-104794612 ATGTATCAAGTTCTGAAATATGG + Intronic
1058442119 9:105019007-105019029 AAGTGTCAAATTATGAAATTAGG + Intergenic
1058905807 9:109481748-109481770 ATGAATAAATTGATAAAATTGGG + Intronic
1060264598 9:122103493-122103515 ATTTATCACTTGATGACATTTGG - Intergenic
1061557336 9:131379185-131379207 ATTCATCAGCTGATGGAATTTGG + Intergenic
1062515801 9:136934896-136934918 ATGTTTCAACACAGGAAATTGGG - Intronic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1186801119 X:13093183-13093205 ATGTAACAACAGCAGAAATTGGG + Intergenic
1186830859 X:13389038-13389060 GTGTTCCTACTGATGAAATTAGG + Intergenic
1188046900 X:25435905-25435927 ACTAATTAACTGATGAAATTAGG - Intergenic
1189588011 X:42480974-42480996 ATGTATTAAATGGTGCAATTTGG + Intergenic
1191790683 X:64969130-64969152 ATGTTTCAACACATGAAATTTGG + Intronic
1191951544 X:66598766-66598788 ATGTATTAACTGAAGAAATACGG + Intronic
1193484558 X:82070821-82070843 ATGTCTAAAATTATGAAATTTGG - Intergenic
1194617896 X:96129880-96129902 ATCAATAAACTGATGAAATACGG - Intergenic
1194777929 X:97988820-97988842 AAGTTTCAAGTGATGAAATTTGG + Intergenic
1194919862 X:99751302-99751324 ATGGATCAACTGACAAAATTGGG + Intergenic
1196095520 X:111794347-111794369 ATATAGTAACTGTTGAAATTAGG + Intronic
1196521674 X:116681202-116681224 ATTTATCACCTGATGACATTTGG + Intergenic
1196566182 X:117207486-117207508 ATGTAACAGCTGAGGAAATCAGG - Intergenic
1199433188 X:147783753-147783775 ATTTATCAGCTGATGGACTTTGG - Intergenic
1199688701 X:150289767-150289789 ATGTAACAACTGAGGAAAACTGG + Intergenic
1201265707 Y:12204558-12204580 ATGGAACCACTGATGAAATTTGG + Intergenic