ID: 1045420332

View in Genome Browser
Species Human (GRCh38)
Location 8:102008326-102008348
Sequence GAACCTATTCCTGTCCCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045420332_1045420337 21 Left 1045420332 8:102008326-102008348 CCCTTAGGGACAGGAATAGGTTC No data
Right 1045420337 8:102008370-102008392 TAAGAACTGATTTTTTTAAAAGG No data
1045420332_1045420335 -2 Left 1045420332 8:102008326-102008348 CCCTTAGGGACAGGAATAGGTTC No data
Right 1045420335 8:102008347-102008369 TCTAGTTCTAGGTCTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045420332 Original CRISPR GAACCTATTCCTGTCCCTAA GGG (reversed) Intronic