ID: 1045420442

View in Genome Browser
Species Human (GRCh38)
Location 8:102009395-102009417
Sequence TCTACCCTGAATAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045420442_1045420446 11 Left 1045420442 8:102009395-102009417 CCTGCCATTTTATTCAGGGTAGA 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1045420446 8:102009429-102009451 TTCCGTCTCCCTGAATAAGGAGG No data
1045420442_1045420450 22 Left 1045420442 8:102009395-102009417 CCTGCCATTTTATTCAGGGTAGA 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1045420450 8:102009440-102009462 TGAATAAGGAGGAAAGCTCAAGG No data
1045420442_1045420445 8 Left 1045420442 8:102009395-102009417 CCTGCCATTTTATTCAGGGTAGA 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1045420445 8:102009426-102009448 TGTTTCCGTCTCCCTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045420442 Original CRISPR TCTACCCTGAATAAAATGGC AGG (reversed) Intronic
909568759 1:77084515-77084537 TGTACCTTGCTTAAAATGGCTGG + Intergenic
911043369 1:93609174-93609196 CCTACCCTGAAAAAAATATCTGG - Intronic
915301501 1:154954067-154954089 TCTTCCCTGACTCAAATGTCAGG - Intronic
920724475 1:208420962-208420984 TCTAACCTGAGTGAAATGCCAGG - Intergenic
920739558 1:208567652-208567674 TATACCCTGAAGGAAATTGCAGG + Intergenic
921943987 1:220873926-220873948 TTTCCCCTGAAGAAATTGGCTGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063789793 10:9429739-9429761 TCTACCCTGAATTAACTGCATGG + Intergenic
1068106714 10:52627113-52627135 TCTTACCTGAAAAAAATGGATGG - Intergenic
1068823860 10:61410893-61410915 TCCACCCTGAATTAAATTACTGG - Intronic
1069699740 10:70414173-70414195 TCAACCATGGATAAAATGGCAGG - Intronic
1070206914 10:74273310-74273332 TCAGGCCTGAACAAAATGGCTGG - Intronic
1072073596 10:91945794-91945816 TATACCCAGAAGTAAATGGCTGG + Intronic
1072260586 10:93667334-93667356 TCTACCCTCAATACAATTTCTGG - Intergenic
1074459367 10:113623468-113623490 TCTCCCCGGTATAAAAAGGCAGG + Intronic
1076876074 10:133216254-133216276 TCTCACCTGAAGAAAATGGGGGG + Intronic
1076929791 10:133523875-133523897 TCAGCCCTGGATAAAATAGCAGG + Intronic
1079408125 11:20162904-20162926 TCCACCCTCCAAAAAATGGCAGG - Intergenic
1080210185 11:29776974-29776996 GCTTCCCTGAATAAAATCTCAGG - Intergenic
1080807977 11:35673348-35673370 TCTGCCATGAATAAAATCACTGG - Intronic
1084428801 11:69100197-69100219 GTTGCCCTGAATAGAATGGCTGG + Intergenic
1087463804 11:98478605-98478627 TCTACCATAAATAAAAAGGAGGG - Intergenic
1088488329 11:110363047-110363069 TTTTCCCTGAATAGAATGACTGG + Intergenic
1093255475 12:16861367-16861389 CCTAGCCTGAGTAAAATGTCAGG - Intergenic
1094207993 12:27860756-27860778 TCATCCCTGAAACAAATGGCTGG - Intergenic
1095324155 12:40867320-40867342 TCTACCATTAATAAAATGGAAGG + Intronic
1096442125 12:51651837-51651859 TCTTCCCTGGAGAAATTGGCAGG - Intronic
1098313663 12:69171837-69171859 TGTATGCTGAACAAAATGGCTGG - Intergenic
1100439740 12:94605738-94605760 CCTACGATGAACAAAATGGCAGG + Intronic
1104744508 12:131202566-131202588 TCTGCCCTGGATCAAATAGCTGG + Intergenic
1104789868 12:131474637-131474659 TCTGCCCTGGATCAAATAGCTGG - Intergenic
1106280993 13:28271031-28271053 TGAACTCTGAATAAAATGCCTGG + Intronic
1107106681 13:36650736-36650758 TATTCTCTGAATAAAATGGCTGG - Intergenic
1108924907 13:55730216-55730238 TCTTCCCTGAAACAAAAGGCAGG + Intergenic
1110045312 13:70821375-70821397 TCTAACCTCAAGAAATTGGCAGG + Intergenic
1112354977 13:98666732-98666754 TTTACCCTGAAGAAAATCTCAGG + Intergenic
1121005239 14:90486368-90486390 TGTAACCTGAATAAAATGCAAGG - Intergenic
1124062801 15:26310174-26310196 TTCACCTAGAATAAAATGGCTGG + Intergenic
1126261584 15:46699341-46699363 CCTAGCCTGAATCAAATGGTAGG + Intergenic
1126890224 15:53197172-53197194 TGTTTCCTGATTAAAATGGCTGG - Intergenic
1127569748 15:60230413-60230435 TCTTCCCTGAATGACATGGGGGG - Intergenic
1136751612 16:32641354-32641376 TATACCCAGAATTAAATTGCTGG + Intergenic
1137998605 16:53248685-53248707 TCTACCCAAAATAAATTAGCTGG - Intronic
1138722959 16:59103390-59103412 TCTATCATGAATAATATGGCGGG + Intergenic
1140313919 16:73874776-73874798 TCTACCCTAAACAGAAAGGCAGG - Intergenic
1203053747 16_KI270728v1_random:900609-900631 TATACCCAGAATTAAATTGCTGG + Intergenic
1150839872 17:68597843-68597865 TCGACCCTGCACATAATGGCAGG + Intronic
1151020690 17:70613494-70613516 GCTACATTGAATAATATGGCTGG - Intergenic
1153599441 18:6764758-6764780 TCAAGCCTGAAAACAATGGCTGG + Intronic
1154082936 18:11276078-11276100 TCTTCCCTTAATGAAAGGGCTGG + Intergenic
1157155078 18:45257456-45257478 TCTTCTTTTAATAAAATGGCAGG + Intronic
1162482436 19:10936110-10936132 TCTCCCTTGAAAAAAAAGGCGGG + Intergenic
926601093 2:14846202-14846224 TTTCCACTGAAAAAAATGGCTGG - Intergenic
928962288 2:36940323-36940345 TCTACTCAGAAACAAATGGCAGG + Intronic
928981533 2:37140530-37140552 TAGACCCTGAATTAAATAGCTGG + Intronic
929689614 2:44063485-44063507 TCTAGCTTTAAAAAAATGGCGGG - Intergenic
931257404 2:60585332-60585354 TCTTCCCTGTCTGAAATGGCAGG + Intergenic
932652497 2:73573715-73573737 TCTATCCTGAACAATATTGCTGG + Intronic
934628789 2:95891588-95891610 TCTTCCCTGAATAAATCAGCGGG - Intronic
934631104 2:95923417-95923439 TCTTCCCTGAATAAATCAGCGGG - Intronic
934802941 2:97185566-97185588 TCTTCCCTGAATAAATCAGCGGG + Intronic
934803483 2:97193108-97193130 TCTTCCCTGAATAAATCAGCGGG + Intronic
934803910 2:97198713-97198735 TCTTCCCTGAATAAATCAGCGGG + Intronic
934804326 2:97204318-97204340 TCTTCCCTGAATAAATCAGCGGG + Intronic
934804601 2:97208061-97208083 TCTTCCCTGAATAAATCAGCGGG + Intronic
934832736 2:97547459-97547481 TCTTCCCTGAATAAATCTGCGGG - Intronic
942940992 2:181616792-181616814 TCTACCATTAATAAAAAGGTAGG + Intronic
947421124 2:229942403-229942425 CCTACCCTGCATAAAAATGCTGG + Intronic
1169411829 20:5377502-5377524 TCCACACTGAATAAAGGGGCTGG + Intergenic
950305498 3:11912921-11912943 TGTTCCCTGAATAGAAGGGCAGG - Intergenic
951799937 3:26584799-26584821 TGGACCCTCAATAAAAGGGCAGG + Intergenic
955880052 3:63533734-63533756 TGAACCCTGAATAGCATGGCTGG - Intronic
963383788 3:144565092-144565114 TTTACCCTGAATAAAATTTGAGG + Intergenic
965962806 3:174448687-174448709 TCTTCCCTGACTAAAATAGCAGG + Intronic
969041596 4:4301286-4301308 TGTACCCAGAATAAAGTGCCTGG + Intronic
969187576 4:5488383-5488405 TCTGCTCTTAATAAAATTGCAGG - Intronic
971045322 4:22799423-22799445 TCTAGCCTGAATGCAAAGGCAGG - Intergenic
975916556 4:79332209-79332231 TCTCCCCTGACTCAAGTGGCTGG - Intergenic
978741598 4:112144255-112144277 TTTTCCTTGAATAAAATGGATGG + Intergenic
980292940 4:130869209-130869231 TCTGCCTTTAATAAGATGGCAGG + Intergenic
988306880 5:29504272-29504294 TCCATTCTGAATAGAATGGCAGG + Intergenic
990349422 5:54900785-54900807 CCTACCCTGAAGAAAGGGGCTGG + Intergenic
990635980 5:57726728-57726750 TCCACCCTGGGCAAAATGGCAGG - Intergenic
995705723 5:114987449-114987471 TCTTCCTTGAAAAAAATGGATGG + Intergenic
996234743 5:121111591-121111613 TATACCCTGAGGAAGATGGCAGG - Intergenic
998093212 5:139382842-139382864 ACTTCCCTGGCTAAAATGGCAGG - Intronic
999589248 5:153125731-153125753 GCTACCCTGAATAAACAGGATGG - Intergenic
1001993961 5:176140141-176140163 TATACCCAGAATTAAATTGCTGG + Intergenic
1003890888 6:10562764-10562786 TCTACCCTGAAGCCAAGGGCTGG + Intronic
1004506445 6:16250632-16250654 TCTACCTTGAATTACCTGGCAGG - Intronic
1004676866 6:17851239-17851261 TATACCTTGATTTAAATGGCTGG + Intronic
1004736990 6:18416802-18416824 TCTTCCCTGATTAGAATGGAGGG + Intronic
1004934301 6:20492184-20492206 TCTACCTGGAGTAAACTGGCTGG - Exonic
1006748156 6:36359642-36359664 TCAATACAGAATAAAATGGCAGG - Intronic
1008978852 6:57459767-57459789 AGTACCCTGGATAACATGGCTGG - Intronic
1009166987 6:60352756-60352778 AGTACCCTGGATAACATGGCTGG - Intergenic
1009339838 6:62540986-62541008 ATTACCCTTAATAAATTGGCGGG - Intergenic
1010759289 6:79703859-79703881 TATACCTTGAATAGAATTGCTGG + Intergenic
1014992720 6:128102553-128102575 TCTTTCCTGTCTAAAATGGCAGG - Intronic
1016551661 6:145287093-145287115 TGTACCCTGAAGTGAATGGCAGG + Intergenic
1016935811 6:149448791-149448813 TTTACCATGAATGAAAGGGCTGG + Intronic
1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG + Intronic
1018152522 6:160953852-160953874 TCCACTCTGAAGAAAATGGAGGG - Intergenic
1027452651 7:78350717-78350739 TCCACAATGAAGAAAATGGCAGG - Intronic
1027476810 7:78642050-78642072 TCTTCCCTGTATGAAATGTCTGG - Intronic
1027974934 7:85140842-85140864 TCTACCATTAAAAAAATGGTAGG + Intronic
1030645814 7:112060450-112060472 TATACCCAGAATAGAATTGCTGG - Intronic
1030800939 7:113850984-113851006 TTTTCCCTGAATAAAATGAAAGG + Intergenic
1031645387 7:124219802-124219824 TCTCCCCTGAATAATACAGCCGG + Intergenic
1038673082 8:29597891-29597913 TCTTCCCTGAGTTAAATGTCGGG - Intergenic
1038775775 8:30529258-30529280 TGTACACTAAAAAAAATGGCAGG - Intronic
1039650166 8:39332856-39332878 TCATCTCTGAATCAAATGGCAGG - Intergenic
1041177376 8:55210529-55210551 TCTCCCATGAATAAAATGGCAGG + Intronic
1043843228 8:85133905-85133927 ACTACTCTGAATAAAATGAAGGG - Intronic
1044079072 8:87861647-87861669 ATTACCCTGCATAATATGGCTGG + Intergenic
1045420442 8:102009395-102009417 TCTACCCTGAATAAAATGGCAGG - Intronic
1046473534 8:114711036-114711058 TTTACCCTGAAGAAAATGTCTGG - Intergenic
1047239851 8:123076627-123076649 TCTACCATGAATACCCTGGCAGG - Intronic
1052595001 9:30545754-30545776 ACTAGGCTGAATAAAATGGGTGG + Intergenic
1055520764 9:77078920-77078942 TATAACCTCAAGAAAATGGCAGG + Intergenic
1057103016 9:92381561-92381583 TCCAGCCTTAATAAAAAGGCAGG - Intronic
1058061340 9:100499901-100499923 TCAACCATGAAGAAACTGGCTGG - Intronic
1060884940 9:127144484-127144506 TATACCCTGAGTACAATTGCTGG - Intronic
1187181928 X:16950882-16950904 TCTACACAAAATAAAATAGCCGG + Intronic
1188262145 X:28034566-28034588 TATACCCTCAATACAAAGGCAGG + Intergenic
1188782085 X:34297685-34297707 TCCACCCTGAGTAATATGGTTGG + Intergenic
1189146916 X:38664982-38665004 TATACCATGAACCAAATGGCTGG - Intronic
1189410599 X:40767484-40767506 TCTTCCTTGTTTAAAATGGCAGG - Intergenic
1190507031 X:51136445-51136467 TGTACCCTGTATAAAGTGGGTGG + Intergenic
1197186984 X:123598607-123598629 TCTACCTTGGATTAAATGGTAGG - Intergenic
1199147215 X:144382148-144382170 TATTCCCTGAATCACATGGCTGG - Intergenic