ID: 1045423761

View in Genome Browser
Species Human (GRCh38)
Location 8:102042672-102042694
Sequence ACTACCAACCAGACTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045423753_1045423761 21 Left 1045423753 8:102042628-102042650 CCTGGACATTTCATGAGACCCCC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG No data
1045423755_1045423761 2 Left 1045423755 8:102042647-102042669 CCCCAACTAATGAAAGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG No data
1045423758_1045423761 0 Left 1045423758 8:102042649-102042671 CCAACTAATGAAAGCTAGAGGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG No data
1045423754_1045423761 3 Left 1045423754 8:102042646-102042668 CCCCCAACTAATGAAAGCTAGAG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG No data
1045423757_1045423761 1 Left 1045423757 8:102042648-102042670 CCCAACTAATGAAAGCTAGAGGT 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045423761 Original CRISPR ACTACCAACCAGACTCCTTG GGG Intronic
No off target data available for this crispr