ID: 1045425257

View in Genome Browser
Species Human (GRCh38)
Location 8:102059881-102059903
Sequence CTGGTAAAACACAGCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045425249_1045425257 11 Left 1045425249 8:102059847-102059869 CCAACTTTGCAGGCATCAGGATC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1045425257 8:102059881-102059903 CTGGTAAAACACAGCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045425257 Original CRISPR CTGGTAAAACACAGCTGCCA GGG Intronic
No off target data available for this crispr