ID: 1045427362

View in Genome Browser
Species Human (GRCh38)
Location 8:102080489-102080511
Sequence AGCTGGTCATAGAACTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045427357_1045427362 8 Left 1045427357 8:102080458-102080480 CCTGGGCAAACTATTGTTCTGTT 0: 1
1: 0
2: 2
3: 12
4: 155
Right 1045427362 8:102080489-102080511 AGCTGGTCATAGAACTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045427362 Original CRISPR AGCTGGTCATAGAACTTCAG GGG Intronic
No off target data available for this crispr