ID: 1045428100

View in Genome Browser
Species Human (GRCh38)
Location 8:102087217-102087239
Sequence CAGAAGGATGTTACTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 9, 2: 41, 3: 101, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045428100_1045428109 24 Left 1045428100 8:102087217-102087239 CCCTTTCCAGTAACATCCTTCTG 0: 1
1: 9
2: 41
3: 101
4: 376
Right 1045428109 8:102087264-102087286 GAAGAAACCCCCCAACCCAAAGG No data
1045428100_1045428105 -8 Left 1045428100 8:102087217-102087239 CCCTTTCCAGTAACATCCTTCTG 0: 1
1: 9
2: 41
3: 101
4: 376
Right 1045428105 8:102087232-102087254 TCCTTCTGGCAAACCATGGAAGG No data
1045428100_1045428107 -7 Left 1045428100 8:102087217-102087239 CCCTTTCCAGTAACATCCTTCTG 0: 1
1: 9
2: 41
3: 101
4: 376
Right 1045428107 8:102087233-102087255 CCTTCTGGCAAACCATGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045428100 Original CRISPR CAGAAGGATGTTACTGGAAA GGG (reversed) Intronic
900851557 1:5147004-5147026 CAGAAGGCTGTGACAGGCAAGGG - Intergenic
902858691 1:19228497-19228519 CAGGAGGTAGTTACTGGCAAAGG + Intronic
902947324 1:19851035-19851057 CAGATACATGTTACAGGAAAGGG + Intergenic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
907510226 1:54952553-54952575 CAGAAAGATGTTGCAGGAAAGGG - Intergenic
908328152 1:63044055-63044077 CAGAAAGATGTTACAGAAAAGGG - Intergenic
908610708 1:65857041-65857063 CAGCATGATGGTAATGGAAATGG - Intronic
909280330 1:73743192-73743214 CAGAATGTTGCTACTGAAAAAGG - Intergenic
910023597 1:82622959-82622981 CAGAAAGATGTTACAGGAAAGGG - Intergenic
911576888 1:99588624-99588646 CAGAAAGATGTTACCGTAAAGGG + Intergenic
912445418 1:109732307-109732329 GCCAAGGATGTCACTGGAAAGGG + Intronic
913038304 1:114996901-114996923 AATAGGGAAGTTACTGGAAAGGG + Intergenic
913539404 1:119804380-119804402 TAGAAGGATGTGGCTGGATAGGG - Intronic
915473653 1:156139907-156139929 GAGAGGGAGGTCACTGGAAAGGG + Exonic
916532714 1:165673504-165673526 CAGAAAGATGTTACTGCAAAGGG - Intronic
916687683 1:167162019-167162041 CAGATATCTGTTACTGGAAAGGG - Intergenic
916810737 1:168303483-168303505 CAAAAAGATGTTACTGAGAAGGG + Intronic
916889544 1:169103041-169103063 CAGAAGGATCTTACTGCTAGGGG + Intergenic
916954825 1:169820800-169820822 CAGGAAGTTATTACTGGAAAGGG + Intronic
917215820 1:172677018-172677040 CAGAAATAAGTTACAGGAAAGGG - Intergenic
917293382 1:173494078-173494100 CAGAAATACGTTACAGGAAAGGG - Intergenic
917405767 1:174706732-174706754 CAGAGTGTAGTTACTGGAAAAGG - Intronic
917708114 1:177655222-177655244 CAGAAATATGTTACAGGAAAGGG - Intergenic
917891401 1:179441805-179441827 CAGAACCATGCTGCTGGAAATGG - Intronic
918062785 1:181076594-181076616 CAGAAGGAGGTTTCCAGAAAAGG - Intergenic
918578156 1:186090020-186090042 CAAAGGGATGTTACTGAACATGG + Intronic
918581467 1:186135777-186135799 CAAAAGCATGCCACTGGAAATGG - Intronic
920135015 1:203762684-203762706 CAGAAAGGTGTTACAGGGAAGGG - Intergenic
921474130 1:215585050-215585072 CAGGAAGATGTTACTGGAAAGGG + Intronic
921692779 1:218170456-218170478 CAGAAGTATGTAATTGGAACAGG - Intergenic
923297519 1:232609393-232609415 GAGAAGTATGTTGATGGAAATGG - Intergenic
923599278 1:235387759-235387781 GGGAAAGATGTTACAGGAAATGG + Intronic
923601964 1:235411476-235411498 CAGAAAGATGTTACCAGAAAGGG + Intronic
1063102751 10:2964623-2964645 GAGAAGGAAGTTACAGGCAAAGG - Intergenic
1063170903 10:3509081-3509103 GAGAAGCATGTTAATGAAAACGG + Intergenic
1063216265 10:3928768-3928790 CTGAAGGATGTTACTCTAAATGG + Intergenic
1063301637 10:4854498-4854520 AAGAAAGATGTTACAGCAAAGGG - Intergenic
1063472094 10:6296351-6296373 TAGAGGAATGTTACCGGAAAGGG + Intergenic
1063619456 10:7632300-7632322 CAACAGGATGTGACTGCAAATGG + Intronic
1064027858 10:11863109-11863131 AAGAAGGATGTCTCAGGAAAAGG - Intronic
1064232205 10:13538889-13538911 CATAATGATGTTACAAGAAAGGG - Intergenic
1064907194 10:20359360-20359382 CAGAAATATCTTTCTGGAAAAGG - Intergenic
1066977118 10:42379147-42379169 CAGAAAAATGTTACCAGAAACGG + Intergenic
1067771300 10:49128301-49128323 CAGAAGGGTGCTACTCGTAAGGG - Intergenic
1068448849 10:57160839-57160861 TAGAAGAAAATTACTGGAAATGG + Intergenic
1068947270 10:62742036-62742058 CAGAAAGCTTTTACTGTAAAGGG + Intergenic
1069250838 10:66264793-66264815 AGGAAGTATGTTATTGGAAATGG - Intronic
1069760209 10:70805196-70805218 GAGAAGGATGTTCCAAGAAAAGG + Intergenic
1069936351 10:71919967-71919989 CTGAAAGATGTTACCAGAAAGGG + Intergenic
1070026583 10:72637781-72637803 CAAAAAGATCTTTCTGGAAAGGG + Intergenic
1070251344 10:74776244-74776266 CAGAAATATGTTACAGGAAAGGG - Intergenic
1070363447 10:75713000-75713022 GAAAATGATGTTTCTGGAAAGGG + Intronic
1070541856 10:77421209-77421231 AAGAAGGTTGTTACAGGAAAAGG - Intronic
1070651442 10:78239927-78239949 GAGAGGGAGGTCACTGGAAAGGG - Intergenic
1070812507 10:79305523-79305545 CAGAGCGGTTTTACTGGAAAAGG - Exonic
1072443527 10:95478203-95478225 GAGAATGATCTTACTGGAAAGGG + Intronic
1073439677 10:103545060-103545082 CTGAGAGAAGTTACTGGAAAGGG + Intronic
1074690076 10:115996571-115996593 CAGAAAGATGTTACTGGAAAGGG + Intergenic
1076083788 10:127607021-127607043 GAGGAGGATTTGACTGGAAAGGG - Intergenic
1077005195 11:351723-351745 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1077873610 11:6284155-6284177 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1077989926 11:7397152-7397174 ATGAAGGATTTTAATGGAAATGG - Intronic
1078741447 11:14070284-14070306 AATAAGGATTTTACTGGAATTGG + Intronic
1078887532 11:15519451-15519473 GAGAAGGAAGTTAGAGGAAAAGG + Intergenic
1078990835 11:16644337-16644359 CAAAAGATTGTGACTGGAAATGG - Intronic
1079235137 11:18682972-18682994 CAGGAAGATGTTACCAGAAAGGG - Intergenic
1079412317 11:20201037-20201059 CAGAAATATGTTACAGGACAGGG - Intergenic
1080288158 11:30640484-30640506 CAAAAAGATGTTACCGGAAAGGG - Intergenic
1080926632 11:36764084-36764106 GAGAAGGATGTTTAAGGAAAAGG - Intergenic
1081372104 11:42316654-42316676 CAGAATGACGGTACAGGAAAGGG - Intergenic
1082852331 11:57776448-57776470 CAGAAGAATGTGACTGGGAAAGG - Intronic
1082969850 11:59008579-59008601 AAGTAGGATGTTAGGGGAAATGG + Intronic
1083835556 11:65264536-65264558 CAGAAGGATGTTACAGGAGAAGG - Intronic
1084026166 11:66451089-66451111 CAGTAGGAAGTCACTGGAATAGG + Intronic
1084878887 11:72155384-72155406 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1086232641 11:84588966-84588988 CAGAAAGATGTTACCAGAAAGGG - Intronic
1087981989 11:104626641-104626663 CAGTAGGTTGTTTCTGGACATGG + Intergenic
1088459008 11:110063108-110063130 CAGAAGGATGCTACTGAGCACGG - Intergenic
1089488569 11:118866453-118866475 CAGGAAGACGTTACTGGAAAGGG - Intergenic
1090455327 11:126844114-126844136 CAGGAAGATGTTACTGGAAAGGG - Intronic
1090491948 11:127171923-127171945 AAGCATGACGTTACTGGAAATGG + Intergenic
1091458419 12:625569-625591 CAGAAGTAGCTTGCTGGAAAAGG - Intronic
1092136024 12:6147835-6147857 CAGAAATATGTTACAGGAAAGGG - Intergenic
1092268437 12:7001783-7001805 CAGAAAAATGTTAGTGAAAAAGG - Intronic
1092566194 12:9668238-9668260 CAGAACGAAGATTCTGGAAAGGG + Intronic
1092652959 12:10654445-10654467 CAGGAAGATGTTATTGGAAAGGG - Intronic
1093091426 12:14925222-14925244 CAGAAAGATGTTAGTGAAAAGGG - Intronic
1093180652 12:15963505-15963527 CAAAAGCTTGTTGCTGGAAAGGG - Intronic
1094100084 12:26752775-26752797 CAGAATGATGTTACAGGAAAGGG - Intronic
1094594045 12:31847839-31847861 CAGAAAGATGTTACTGGAAAGGG - Intergenic
1095799580 12:46257825-46257847 CAGAAAGATGTTACAGGAAAAGG + Intronic
1096786873 12:54021907-54021929 CAGGAGGGGGTTGCTGGAAAGGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097596142 12:61633831-61633853 CAGAAGGAATTGACTTGAAAGGG - Intergenic
1098439106 12:70499471-70499493 CAGAAAGATGTTACCACAAAAGG + Intergenic
1099249144 12:80230955-80230977 CAGAAGGATGCCAGTGGAGATGG - Intronic
1099450748 12:82803609-82803631 CAGAAGCATTTCACTGGAAAAGG + Intronic
1099799819 12:87442887-87442909 CAAAAATATGTTACAGGAAAGGG + Intergenic
1100982108 12:100170113-100170135 CAGGAGGGTGTTAGTGGGAAAGG - Intergenic
1101598182 12:106185874-106185896 CATAATTGTGTTACTGGAAAAGG - Intergenic
1102015578 12:109645834-109645856 CTGAAGGCTGTCCCTGGAAAGGG - Intergenic
1102074743 12:110050883-110050905 CAGAAATACGTTACAGGAAAAGG - Intronic
1102167558 12:110818815-110818837 CCTGAGGCTGTTACTGGAAAGGG + Intergenic
1103245847 12:119456497-119456519 TAGAAAGATGTTACATGAAAGGG + Intronic
1103412336 12:120721389-120721411 TAGAAGGATGTCACTAGGAAAGG + Exonic
1104127711 12:125863179-125863201 CAGGAAGATATTACAGGAAAGGG + Intergenic
1104196119 12:126540034-126540056 TAGAAGGATTTTACAGGGAAGGG + Intergenic
1104507262 12:129344234-129344256 CAGAAATATGTTACAGGAAAGGG - Intronic
1104552872 12:129773506-129773528 CAGCAGGATGTTCCAGGCAAAGG + Intronic
1104656606 12:130578302-130578324 GAGAAAGATGATTCTGGAAACGG - Intronic
1105635756 13:22213648-22213670 CATAAGGATTTTACTGTAGAGGG + Intergenic
1105778219 13:23682308-23682330 CAGAAAGATGTTACAAGGAAAGG - Intergenic
1106591060 13:31098924-31098946 CAGAAAGATGTTACCGGAAAGGG - Intergenic
1106951534 13:34890080-34890102 CAGCAGCCTGTTTCTGGAAAGGG + Intergenic
1106989820 13:35404999-35405021 AAGAGAGATGATACTGGAAAGGG + Intronic
1107205338 13:37778738-37778760 AATAAGGATGTTACTGAAATTGG + Intronic
1107311237 13:39081263-39081285 CAGGAAGATGTTACCAGAAAGGG - Intergenic
1107970983 13:45641921-45641943 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1107991492 13:45822683-45822705 CAGAAAAATGTTACTTGTAAAGG + Intronic
1109345661 13:61112801-61112823 CAGAAAGATGTTACTGGAAAAGG - Intergenic
1109751893 13:66704635-66704657 CAGAATGATGACAATGGAAATGG + Intronic
1110689870 13:78420613-78420635 CAGAAGGATCTTAATGGGCAAGG - Intergenic
1110744968 13:79041495-79041517 CAGAAGAATTTTATTAGAAAAGG + Intergenic
1111691126 13:91564464-91564486 CCCAAGGATGCTACTTGAAATGG - Intronic
1111863650 13:93740919-93740941 AACAAGAATGTTTCTGGAAAGGG + Intronic
1111958019 13:94779505-94779527 CAGCAGGATGATAGTGGGAAAGG + Intergenic
1114251917 14:20969060-20969082 GAGAAGGAAGGTACTGGAGATGG - Intergenic
1114790242 14:25649880-25649902 CAGAAAGATGTTACCAGAAAGGG + Intergenic
1115129877 14:30042465-30042487 CAGAAAGATGTTACAAGAAAGGG - Intronic
1115481816 14:33868255-33868277 CAGAAATATGTTACAGGACAGGG - Intergenic
1116105206 14:40493959-40493981 CATAGAGATGTTACTGGCAAAGG - Intergenic
1118174470 14:63424214-63424236 AAGATGGAGATTACTGGAAAAGG + Intronic
1118406861 14:65433035-65433057 GAGAAACATGTTACAGGAAAGGG - Intronic
1119101497 14:71884125-71884147 AGGAAAGCTGTTACTGGAAAGGG - Intergenic
1119562303 14:75600536-75600558 TATAACGATGTTACTGGAAAGGG - Intronic
1120394733 14:83954971-83954993 CAGAAATATGTTACAGGACAGGG - Intergenic
1120912953 14:89684139-89684161 CAGAAAGATGTTACCGGAAAGGG - Intergenic
1121462778 14:94094799-94094821 CAGGAGTATATTACTGGAAAGGG - Intronic
1121610574 14:95276072-95276094 CAGGAAGGTGTTACTGGAAAGGG - Intronic
1122592197 14:102861622-102861644 CAGGAAGATGTTACCGGAAAGGG + Intronic
1124388087 15:29226392-29226414 CAGAATGATGTTCCTACAAACGG + Intronic
1125186797 15:36940172-36940194 CAGATAGATTTTCCTGGAAATGG - Intronic
1126080410 15:44955853-44955875 CAGAAGTATGTTCTTTGAAAAGG + Intergenic
1126260390 15:46682560-46682582 GAGAAATATGTTACAGGAAAGGG - Intergenic
1126623831 15:50667035-50667057 CAGAAAGATGTTACCAGAAAGGG - Intronic
1126726483 15:51637174-51637196 CAGGAAGATGTTACCGGAAAGGG + Intergenic
1126913066 15:53435517-53435539 AAGAAGGTTGTTACTGGCAAAGG + Intergenic
1127372302 15:58352838-58352860 CAGAAAGATGTTATCAGAAAGGG + Intronic
1127560463 15:60131408-60131430 CAGAAAGAGGTTACAGCAAAGGG - Intergenic
1127691037 15:61398161-61398183 CACAAAGATCTTCCTGGAAAGGG + Intergenic
1128711617 15:69876300-69876322 CAGAAGGATGATAAGGGAATCGG + Intergenic
1129246377 15:74281487-74281509 CAGAAGTATTTTAGGGGAAATGG - Intronic
1131298291 15:91171913-91171935 CAGAAGGATGATTCTGCAGATGG - Intronic
1131438916 15:92443970-92443992 CAGAAGTCTGTTAGTGGACAAGG - Intronic
1132010372 15:98269813-98269835 CAGAAGCATGTTGATGGGAATGG - Intergenic
1132235929 15:100221696-100221718 CCGAAGGCTGTTTCTGTAAATGG + Intronic
1132742808 16:1423840-1423862 CAGAAATATGTTACAGGAAAGGG + Intergenic
1134280129 16:12809849-12809871 CATAAGACTGTTACTGGAAAGGG - Intergenic
1137595949 16:49723962-49723984 CAGAAGGAATCTTCTGGAAAAGG - Intronic
1137683563 16:50370834-50370856 CAGAAAAATGTTCCTGGAAGTGG + Intergenic
1138954710 16:61957062-61957084 CAGAAGCAAGTTAGTAGAAATGG + Intronic
1139315834 16:66067721-66067743 CAGAAGGAATTCACTGGAAAGGG - Intergenic
1139672900 16:68503822-68503844 CAGAAGGAGGATACTGGTAACGG + Intergenic
1140489999 16:75327430-75327452 CAGAGGGATGTTACGGGGAATGG + Intronic
1140594237 16:76390211-76390233 CAGCAAGATGTTTCTGAAAATGG + Intronic
1143706145 17:8698870-8698892 CAGGAGGCTGTTGATGGAAAGGG + Intergenic
1143981909 17:10877450-10877472 CAAAGGGATGTTAGTGGGAATGG - Intergenic
1145405124 17:22583402-22583424 CAGAAATATGTTACAGGAATAGG + Intergenic
1146566556 17:33918131-33918153 GAGAAGGATTTTCCTGGAAAAGG - Intronic
1148149215 17:45386144-45386166 CGGGAGGATGTCAGTGGAAAGGG + Intergenic
1148613150 17:48978417-48978439 CAGGAAGATGTTACCGGAAAGGG - Intergenic
1148626915 17:49076363-49076385 CAGGAAGATGTTATCGGAAAGGG + Intergenic
1148720911 17:49752537-49752559 AAGATGGATCTTACAGGAAAAGG - Intronic
1148772000 17:50072687-50072709 CTGAAGGATGATTCTGGAAGGGG + Intronic
1149211968 17:54314451-54314473 CAGAAAGATATTACCAGAAAGGG + Intergenic
1149955692 17:61046862-61046884 AAGAATGATGTAAATGGAAATGG + Intronic
1150349463 17:64431436-64431458 CAGGAAGATGTTCCTGGAAAGGG + Intergenic
1151452781 17:74209058-74209080 CAGAGGGATGGTACTGGAGGTGG + Intronic
1151720238 17:75851033-75851055 CAAATGGATGTTCTTGGAAAAGG - Intronic
1152061787 17:78081694-78081716 CAGTGGGATGTGACTGGAAGTGG - Intronic
1153373045 18:4342197-4342219 CAGTAGGGTGTTTCTAGAAATGG + Intronic
1153455813 18:5280933-5280955 CAAAAGGATGGTAGAGGAAAAGG + Intergenic
1153511735 18:5862223-5862245 CAGAAAAATGTTACTGGAAAGGG - Intergenic
1155388663 18:25309123-25309145 CAGAAGGAAGTTAGCGGTAATGG + Intronic
1156256946 18:35407866-35407888 CAGAAGGATGTTTCCAGACAAGG + Intergenic
1156784071 18:40889081-40889103 AAGTAGGATGTTAGAGGAAATGG - Intergenic
1157649540 18:49313775-49313797 CAAAAAGATGTTACCAGAAAGGG - Intronic
1157654656 18:49373156-49373178 GAGAAATATGTTACAGGAAAGGG + Intronic
1157758519 18:50240930-50240952 CAGAAGGATGTTTGTTGAGAGGG - Intronic
1158388570 18:57022792-57022814 CAAAAAGATGTTACCTGAAAAGG - Intronic
1158501121 18:58002905-58002927 CAGAAGTATCGAACTGGAAAGGG - Intergenic
1158821104 18:61159616-61159638 GAGAAAGAAGTTACTGGACAGGG + Intergenic
1159531149 18:69657271-69657293 CAGACGCAAGTTAATGGAAAGGG - Intronic
1160446842 18:78934626-78934648 CAGAAGGCTGGAAGTGGAAAGGG + Intergenic
1164098903 19:22036791-22036813 CAGAAAGCTGTTACTGAAAAGGG - Intergenic
1164118786 19:22247012-22247034 CAGAAAGCTGTTACTGAAAAGGG - Intergenic
1164274013 19:23701006-23701028 CAGAAACATGTTACAGGAAAGGG - Intergenic
1164470043 19:28522632-28522654 GAGAAATATGTTACAGGAAACGG - Intergenic
1164554967 19:29244355-29244377 CAGAAGGATGCCACTGGACCAGG + Intergenic
1164915672 19:32050582-32050604 CGGAAAGATGTTACAGAAAAGGG - Intergenic
1165296008 19:34926305-34926327 CAGAGAGGTGTTACTGGAAAAGG + Intergenic
1166426945 19:42687498-42687520 CTGAATGATGTTACTGAAAGTGG - Intronic
1167808828 19:51810590-51810612 CAGAACCATGTTGCTGGACACGG - Intronic
1167830827 19:52020924-52020946 CAGGAGGATGGTACTGCACAGGG - Intronic
1168482602 19:56734427-56734449 CAGGAGATTGTTACTGGAGATGG + Intergenic
1168623272 19:57895774-57895796 CAGAAAGATGTTACCAGAAAGGG + Intronic
925019936 2:560447-560469 CTGAAGGATGGCACAGGAAAGGG - Intergenic
925853545 2:8107642-8107664 CATACGGTTGTTACCGGAAAAGG - Intergenic
925918028 2:8621069-8621091 CAGGAAGATGTTACCGGAAAGGG + Intergenic
927406500 2:22776012-22776034 CTGAAAGATGTAAGTGGAAAGGG - Intergenic
927678488 2:25124230-25124252 CCCAAGGGTGTTACTGGAAAGGG - Intronic
928353495 2:30585648-30585670 CAGAAGGATGATTATGGATAGGG - Intronic
928806901 2:35169588-35169610 CAGAAGGATGTTAGAGTTAAGGG + Intergenic
928856549 2:35809405-35809427 CACCAGCATGTTACTTGAAAAGG + Intergenic
930117118 2:47727674-47727696 TACCAGGTTGTTACTGGAAAGGG + Intronic
930151200 2:48061578-48061600 CAGAAAGATGTTAGAGCAAAGGG + Intergenic
930837702 2:55812037-55812059 CAGATGGGAGCTACTGGAAAGGG + Intergenic
932827489 2:74955227-74955249 CAGAAAAATGTTACAGGAAAGGG - Intergenic
932860840 2:75289642-75289664 GAGAAATATGTTACAGGAAAGGG - Intergenic
932863325 2:75316751-75316773 CATGAGGTTGTTGCTGGAAATGG + Intergenic
933427377 2:82130001-82130023 CAGATAGATGTTACAGGAAACGG - Intergenic
934028205 2:88017980-88018002 GATGGGGATGTTACTGGAAAAGG + Intergenic
934029247 2:88026902-88026924 CAGAATGATGTTATAGGAAAAGG - Intergenic
934427789 2:93656963-93656985 CACAAAGAAGTTACTGGGAATGG - Intergenic
936487649 2:112940133-112940155 CATAGTGATGTTACTGGAAAAGG + Intergenic
938781706 2:134590486-134590508 CAGAAAGATGTTACCAGAAAGGG + Intronic
939843944 2:147220978-147221000 CAGAAAGATGTTACCAGAAAGGG + Intergenic
941812219 2:169766516-169766538 CAGTATGATGTTCCTTGAAATGG - Intronic
941931213 2:170941509-170941531 GTGCAGGATGTCACTGGAAAGGG - Intronic
942319961 2:174728282-174728304 CAGGTGGGTGTTCCTGGAAAAGG + Intergenic
942403692 2:175630361-175630383 CAGAAGCATATTGCTGGGAATGG + Intergenic
942548889 2:177093566-177093588 CTCATGGATGTTACTGGAACTGG - Intergenic
942964346 2:181873036-181873058 CAGAAAGAGCTTTCTGGAAAAGG + Intergenic
943466480 2:188235413-188235435 CAGAAAGATGTTACAGGAAAGGG - Intergenic
944187760 2:196968273-196968295 CTCAAGGATGTTACTGAAATTGG + Intronic
944533342 2:200685715-200685737 CAGAAGGATACAGCTGGAAAAGG - Intergenic
946424704 2:219587540-219587562 CAGAAAGATGTCACAGGAAAGGG + Intergenic
946451903 2:219787208-219787230 CAGTAGAATGTCAGTGGAAATGG - Intergenic
946818587 2:223607153-223607175 CATAAGGATGCTACTGTAAGAGG - Intergenic
947192580 2:227523086-227523108 CTTAAGGATGTTTCTGGAAGTGG + Intronic
947497422 2:230648120-230648142 CTTCAGGATGTTACAGGAAAGGG - Intergenic
948918029 2:241048168-241048190 CAGAAGCTTATTTCTGGAAATGG - Intronic
1168738813 20:169856-169878 GAGAAGGCTCTCACTGGAAAAGG + Intergenic
1169313119 20:4564668-4564690 GAGAAACATGTTACTGAAAATGG + Intergenic
1169389894 20:5181373-5181395 CAGAAAGATGTTACCAGAAAGGG + Intronic
1169683869 20:8248421-8248443 CAGAAGGCTGAGAATGGAAATGG - Intronic
1170386045 20:15818094-15818116 CTCAAGGCTGTTGCTGGAAAGGG + Intronic
1170873336 20:20228745-20228767 CAGTAGGCTGTTTCTGGGAAGGG - Intronic
1171028139 20:21651737-21651759 CAGAAAGATGTTATAGGAAAGGG - Intergenic
1171028810 20:21657393-21657415 CAGAAGGATGTTATAGGAAAGGG - Intergenic
1171421180 20:25018774-25018796 CAGAAGGTTTTTACTGTTAATGG + Intronic
1171474962 20:25401445-25401467 CAGAATCATGTTGCTGGACATGG - Intergenic
1172635795 20:36408835-36408857 AAAAAGGACGTTAATGGAAATGG + Intronic
1172927602 20:38553003-38553025 CAGAAGGATGCTAATGGAGTGGG + Intronic
1173194064 20:40899514-40899536 CAGAAGGATTTTACTGTAACTGG - Intergenic
1173532776 20:43783103-43783125 TAGGAAGAGGTTACTGGAAAGGG + Intergenic
1173587004 20:44190250-44190272 CAAAACGAAGTTACTGGTAAAGG + Intergenic
1173731381 20:45331111-45331133 CAGAAAGATGTTACCAGAAAGGG - Intronic
1175372947 20:58504787-58504809 CAGATCGATGTTCCTGGGAATGG - Intronic
1175440314 20:58986093-58986115 CAGGAGGATGATTCTGGAGAAGG + Exonic
1175489608 20:59371010-59371032 CAGAAGCATGTTGCTGGAGGAGG + Intergenic
1175648973 20:60700126-60700148 CAGAAGGACGTTACCTGAACTGG - Intergenic
1175858993 20:62139598-62139620 CAGAACAATGTTACTGAAATTGG + Intronic
1177684232 21:24416629-24416651 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1178459585 21:32790580-32790602 CATAAAGATGTTACCAGAAAGGG + Intergenic
1178460634 21:32799118-32799140 TAGAAGGATGGTTCTGCAAAGGG + Intronic
1179024837 21:37671349-37671371 CACATGGATGTTCCTGGAAGGGG + Intronic
1182198593 22:28545115-28545137 AAGTGTGATGTTACTGGAAAGGG - Intronic
1182625179 22:31640504-31640526 CAGAATGATGTCTCTAGAAAGGG - Intronic
1183113304 22:35669227-35669249 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1184323050 22:43757658-43757680 CAGGAGGATGTGATTGGGAAGGG - Intronic
1184415480 22:44349595-44349617 CAGGAGGATGTTATAGGATAGGG - Intergenic
1185042787 22:48513981-48514003 CAGAGGGAAGTGACAGGAAAGGG - Intronic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
952123687 3:30275138-30275160 CAGAAATATGTTTCAGGAAAGGG - Intergenic
952294490 3:32049301-32049323 CAGCAAGATGTTACTAAAAAGGG - Intronic
953153164 3:40343787-40343809 CAGGAAGAAGTTACTGGAAAGGG - Intergenic
953416072 3:42718577-42718599 CAGAAAGATGTTACAGGAAAGGG - Intronic
953609764 3:44437864-44437886 CAGAAATATGTTACAGGAAAGGG + Intergenic
953846131 3:46427995-46428017 CAGAACCATGCTGCTGGAAATGG + Intergenic
954079181 3:48203027-48203049 CAGAAAGATGCTACAGGAAAGGG - Intergenic
955007426 3:54982527-54982549 CAGAAAGATGTTACTGGAAACGG + Intronic
955381101 3:58439067-58439089 CAGAAAGATGTTATAGGAAAGGG + Intergenic
955453508 3:59096222-59096244 CAGAAATATGTTACAGGAAAGGG - Intergenic
955526566 3:59826349-59826371 CAAATGGAAGTTGCTGGAAAAGG - Intronic
955886644 3:63606345-63606367 CAGAAGCTTGTTTATGGAAAAGG + Intronic
955956626 3:64296544-64296566 CAGAAAAATGTTACTTGAAGTGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
956760080 3:72434601-72434623 GAGATGGATGTAACTGTAAAAGG - Intronic
957379790 3:79412075-79412097 CTGAAGGCTCTTACTGGGAATGG + Intronic
957510656 3:81183725-81183747 AAGTAACATGTTACTGGAAATGG - Intergenic
957539206 3:81546919-81546941 CGGAAAGATGTTACCGGAAAGGG - Intronic
958876450 3:99623016-99623038 CAAAAGTATGGTACTGGACAGGG + Intergenic
958932147 3:100218678-100218700 AAGAAGGATGTTGCTCAAAATGG + Intergenic
960152296 3:114262515-114262537 CAAAAAGATATTACTGGAAAGGG + Intergenic
960304338 3:116042828-116042850 AAGAATGATGTTACTGAACAAGG + Intronic
960386362 3:117026324-117026346 CAGAAATATGTTACAGGAAAGGG - Intronic
960514638 3:118590178-118590200 CAGAAAGATGTTACAAGAAAGGG - Intergenic
960873414 3:122273829-122273851 AAGAAGGATGTGTCAGGAAAAGG + Intronic
961510938 3:127403056-127403078 AAGAAAGATATTACCGGAAAGGG + Intergenic
961533982 3:127558095-127558117 CAGAGGCATGTTACTCGCAAAGG + Intergenic
961690722 3:128667553-128667575 CAGAAATATGTTACAGGACAGGG - Intronic
961925791 3:130478818-130478840 AAGAAGGGTGTTGCTAGAAATGG + Intronic
962365093 3:134773549-134773571 AAGAATGATGTTCATGGAAATGG - Intronic
963410369 3:144920101-144920123 CAGTAGGCTGTTATTGAAAAGGG - Intergenic
964374570 3:156036396-156036418 AAGAAGCTTGTTACTGGAAAAGG + Intergenic
964585357 3:158292647-158292669 CAGAAGGATCTTACAACAAATGG - Intronic
964655547 3:159062657-159062679 AAGCATGATGTTACTGTAAATGG - Intronic
965588779 3:170342978-170343000 CAGAAATATGTTACAGGACAGGG + Intergenic
965791153 3:172389015-172389037 CAGAAGGATGTTACCTTCAAGGG + Intronic
966147081 3:176824048-176824070 CAGAAATATGTTACAGGAAAGGG + Intergenic
968155810 3:196379856-196379878 CAGAATGATGTTACTGGAAAGGG + Intronic
968532568 4:1101241-1101263 CAGAAGGATATAACTTGAAGAGG - Intronic
969420427 4:7091127-7091149 CAGAAAGATGTTACAGGAAAGGG + Intergenic
969634493 4:8358991-8359013 CAGAAAGATGTTACAGGAAAGGG - Intergenic
970216424 4:13763585-13763607 GAGAAGGAAGTTCATGGAAAGGG - Intergenic
971618090 4:28819816-28819838 TATAAGGATATAACTGGAAAAGG + Intergenic
973225479 4:47779022-47779044 CAGTTGGGTGTTATTGGAAATGG - Intronic
973581736 4:52350625-52350647 CAGAAATATGTTACAGAAAAGGG + Intergenic
974052049 4:56950521-56950543 CAGAAATATGTTTCAGGAAAGGG + Intergenic
974072943 4:57141507-57141529 CAGGAAGATGTTATGGGAAAGGG + Intergenic
974585480 4:63870023-63870045 CAGAAGGATGTAATTTGTAATGG + Intergenic
974614880 4:64267852-64267874 CAGAAAGATGTTACTGGAAAAGG + Intergenic
975413602 4:74083226-74083248 CAGAAAGATGTTACCAGAAAGGG - Intergenic
975432962 4:74316535-74316557 CAGAAGGAATTTAATGCAAACGG + Intergenic
975774046 4:77764586-77764608 CAGAAAGATGTTACTGGAAAGGG - Intronic
976359327 4:84159021-84159043 CAGAAGGAGGTGACTTAAAAAGG + Intergenic
976643297 4:87361866-87361888 CAGAAAGATGTTACCAGAAAGGG - Intronic
976699974 4:87959529-87959551 CAGAAAGATGTTACCAGAAAGGG - Intergenic
976758320 4:88522459-88522481 TAGAAGGAAATCACTGGAAAAGG + Intronic
976767165 4:88609703-88609725 GAGAAATATGTTACAGGAAAGGG + Intronic
977047764 4:92089042-92089064 CAGAAAGATGTTACAGGAAAGGG + Intergenic
977499712 4:97823658-97823680 CAGAAAGATATTACCAGAAAGGG - Intronic
977589700 4:98813073-98813095 CAAAAAGATGTTACTGAAAAGGG - Intergenic
977674720 4:99734364-99734386 CAGAAATATGTTACAGGAAAGGG + Intergenic
978108021 4:104928363-104928385 CAGAATAATGTTACATGAAATGG + Intergenic
978317634 4:107457339-107457361 TAGAAGGACATTACAGGAAAAGG - Intergenic
979773454 4:124558718-124558740 CAAAAAGATGTTACAGGAAAGGG - Intergenic
980217171 4:129867259-129867281 CAGCATGATGCCACTGGAAATGG - Intergenic
980987657 4:139711248-139711270 GAGAAATATGTTACAGGAAAAGG + Intronic
981464884 4:145056572-145056594 CAGAAAGATGTTACAAGGAAAGG - Intronic
981998479 4:151001025-151001047 CATAAGGATCTGTCTGGAAATGG + Intronic
982132636 4:152244372-152244394 CTGATGTATGTTGCTGGAAAAGG - Intergenic
982863969 4:160487788-160487810 CAGGAAGATGTTACAAGAAAAGG - Intergenic
983765370 4:171474743-171474765 ATGAAGGAAGTAACTGGAAAGGG - Intergenic
983872758 4:172841181-172841203 CAGAAATATGCTACTGGAAATGG + Intronic
984051994 4:174875785-174875807 CAGCAGAATGTTTCTGTAAATGG - Intronic
984097616 4:175451285-175451307 CAGAAAGATATTACAGGAAAGGG + Intergenic
984441267 4:179773921-179773943 CCGAAAGATGTTACAGGAAAGGG - Intergenic
984650827 4:182269006-182269028 AAGAAATATGTTACAGGAAAGGG - Intronic
984849571 4:184142390-184142412 CAGATGTATTTTCCTGGAAAAGG - Intronic
985224823 4:187748652-187748674 CAGAAGAGTCTTAATGGAAAGGG + Intergenic
985897608 5:2758169-2758191 CAGAAGGATGATGCTGACAATGG + Intergenic
986862346 5:11941834-11941856 CTGAAGCATGTGAGTGGAAAGGG + Intergenic
986968611 5:13305359-13305381 CAGAAAGATGTTACAGGATGGGG + Intergenic
987991847 5:25222922-25222944 CATAAGGATTTTTCTGAAAAAGG - Intergenic
988958371 5:36342729-36342751 CAGAAGGATGAGAGTGGGAAGGG + Intergenic
989638983 5:43565133-43565155 CAGAAAGACGTTACTGGAAAGGG - Intergenic
989743029 5:44794091-44794113 CAGGAAGATGTTACTGGAAAGGG + Intergenic
990314726 5:54573406-54573428 CAGAGGCTTGTTACAGGAAAGGG - Intergenic
990894077 5:60678249-60678271 CAGAAGGGTGCGACTGTAAAGGG - Intronic
991570657 5:68050108-68050130 CAGAAGGATTTTAATTGCAAAGG - Intergenic
991593932 5:68283182-68283204 CACAACAATGTTACTGTAAATGG - Intronic
992494959 5:77282883-77282905 CAGAAGGATGTTATGAGAATTGG + Intronic
992917636 5:81474964-81474986 CAGCAGGATGAAAATGGAAAGGG + Intronic
993043176 5:82838305-82838327 CAGAAAGATGTTATAGGAAAGGG - Intergenic
993099781 5:83523455-83523477 CAGAAAAATGATACTCGAAAGGG - Intronic
993108749 5:83629722-83629744 CATAGAAATGTTACTGGAAAGGG - Intergenic
993401010 5:87450969-87450991 CATAAGGATGGTGCAGGAAAGGG + Intergenic
994197805 5:96938683-96938705 CAGAAGTATGTTACCTGAACAGG - Intronic
994929321 5:106160950-106160972 CTGAATAATGTTAATGGAAAGGG + Intergenic
996058021 5:119001541-119001563 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1000060972 5:157655077-157655099 CAGAAAGAAGTTACAGGAAAGGG - Intronic
1000061364 5:157659274-157659296 CAGAAAGATGTTACAGGAAAGGG - Intronic
1000066247 5:157695270-157695292 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1000415563 5:160980483-160980505 CAGAAAGATATTACAAGAAAGGG - Intergenic
1001707569 5:173752698-173752720 CAGAAGGATGCTAATTGACAAGG + Intergenic
1001731241 5:173961469-173961491 CAGAATGGTGTGTCTGGAAAGGG + Exonic
1004024014 6:11801214-11801236 TACCAGGTTGTTACTGGAAAGGG + Intronic
1004432268 6:15555910-15555932 CAGGAAGATGTTACTGGAAATGG - Intronic
1004732800 6:18374790-18374812 CTCAGGGATGTTACTGGAACTGG + Intergenic
1005448934 6:25954369-25954391 CAGAAAGATGTTACCAGAAAGGG + Intergenic
1006560032 6:34903196-34903218 AAGACAGAAGTTACTGGAAATGG - Intronic
1007353449 6:41292364-41292386 CAGAAAGATGTTACAGGAAATGG + Intergenic
1008291557 6:49722036-49722058 TGGAAAGATGTTACAGGAAAGGG + Intergenic
1008559066 6:52705472-52705494 CAGAAAGATGTTAGAGGAAAGGG - Intergenic
1008969219 6:57347128-57347150 CAGAAGGATTCTCCTGGAATGGG - Intronic
1010030802 6:71269027-71269049 CAGTGGGATGTTGCTGGAAGAGG - Intergenic
1010811092 6:80299442-80299464 CAGAAAGATGTTACTGGAAGGGG + Intronic
1011292819 6:85794062-85794084 CAGGAAGATGTTACTGGAAAAGG + Intergenic
1012647178 6:101700312-101700334 CAGTTTGATGTTATTGGAAAAGG + Intronic
1013374173 6:109498054-109498076 CAGAACGCTGCTACTGAAAATGG - Intronic
1013473751 6:110488581-110488603 CAGAAAGTTGTTACTGGAAAGGG - Intergenic
1013523414 6:110953383-110953405 CAGGAAGATGTTACTGGAAAGGG - Intergenic
1013670679 6:112399400-112399422 CAGAGGGGTGTTACTGGCTATGG - Intergenic
1015240393 6:131016218-131016240 CAGAATAATTTTGCTGGAAAAGG - Intronic
1015746820 6:136518748-136518770 CACACAGATGTTAATGGAAATGG + Intronic
1016006346 6:139092767-139092789 CAGAAAGATGTTAGCAGAAAGGG - Intergenic
1016080246 6:139846733-139846755 GAGAGGGAAGGTACTGGAAAAGG - Intergenic
1016295746 6:142572356-142572378 CAGAAAGATGTTACCGGAACAGG - Intergenic
1017610272 6:156178107-156178129 CGGAAAGATGTTACTGGAAAGGG - Intergenic
1017755768 6:157527752-157527774 CAGGAAGTTGTTTCTGGAAATGG + Intronic
1017862086 6:158408256-158408278 CAGAAGGGTGTTCCTGGCCAAGG + Intronic
1017892149 6:158647656-158647678 CAGATGGAAGGTGCTGGAAATGG - Intergenic
1018357619 6:163034758-163034780 CAGAAAAATGTTACAGGGAAGGG + Intronic
1019823462 7:3263673-3263695 CAGAAAGATATTACAGGAAAGGG - Intergenic
1020401043 7:7777864-7777886 CTGAATGAAGTTACTGGTAAAGG - Intronic
1022415378 7:30172609-30172631 TAGAATGAAGTAACTGGAAAAGG - Intergenic
1022747227 7:33184709-33184731 CAGGAGAATGTTACTGGAAAGGG + Intronic
1022864372 7:34401726-34401748 CACAAAGATATCACTGGAAATGG - Intergenic
1022951155 7:35339411-35339433 TGGAAGGGTGTTGCTGGAAATGG + Intergenic
1023588847 7:41759447-41759469 CAGAAAGATGTTACAGGAAAAGG + Intergenic
1023692460 7:42805443-42805465 CAGAAGGAAGATAATGTAAAAGG + Intergenic
1024100994 7:46032796-46032818 CAGAAGGAAGTGCATGGAAATGG + Intergenic
1024416217 7:49109992-49110014 CAGAAGAGTTTAACTGGAAATGG - Intergenic
1024836769 7:53529867-53529889 GAGATGGAAGTTTCTGGAAATGG - Intergenic
1026449274 7:70513112-70513134 AATAAGGCTGTTACTGTAAAGGG - Intronic
1027368882 7:77486974-77486996 CAGAAGGATGTTGCTGGCAGTGG - Intergenic
1027856179 7:83514419-83514441 GAGAAATATGTTACAGGAAAGGG - Intronic
1028389233 7:90295599-90295621 CAGAAGGATGTTACAGGAAAGGG + Intronic
1028614835 7:92754831-92754853 AAGATGGATCTTTCTGGAAATGG + Intronic
1029004856 7:97198573-97198595 AACAAGGTTGTGACTGGAAATGG + Intergenic
1030190031 7:106801266-106801288 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1031380294 7:121077284-121077306 GAGAAGGAAGTTAATGAAAATGG + Intronic
1031418281 7:121519079-121519101 GAGAAAGATGGTATTGGAAAAGG + Intergenic
1031472067 7:122177587-122177609 GAGAAGGATGTTACTGTTACGGG - Intergenic
1031977046 7:128100787-128100809 CAGAAGGAAGTTAGTGGTAGGGG + Intergenic
1032461642 7:132115776-132115798 CATAATAGTGTTACTGGAAAGGG - Intergenic
1034245852 7:149643757-149643779 GAGAGGGATGATAGTGGAAAGGG - Intergenic
1034797516 7:154027813-154027835 CTGAAGGAAGATACTGGAAGAGG - Intronic
1037311215 8:17558737-17558759 GTAAAGGATGTTTCTGGAAAAGG + Intronic
1038482826 8:27913522-27913544 CAGATGCATGTAGCTGGAAAGGG - Intronic
1041669283 8:60476768-60476790 AAGAAGGAGGTAACTGAAAAAGG - Intergenic
1043070596 8:75631204-75631226 CAGAAATATGTTACAGGACAGGG + Intergenic
1043167977 8:76928046-76928068 CAGAAGGAAGGGACTGAAAAGGG - Intergenic
1044378650 8:91505108-91505130 CGGAAGGATGTTACCAGAAAGGG + Intergenic
1044439734 8:92209161-92209183 CAGAAAGATGTTACCGGAAAGGG + Intergenic
1044535772 8:93354928-93354950 GTGAAGGATGTAACTGGAATGGG + Intergenic
1045428100 8:102087217-102087239 CAGAAGGATGTTACTGGAAAGGG - Intronic
1045688605 8:104737247-104737269 CAGAAAGATACTACAGGAAAGGG - Intronic
1046361332 8:113161286-113161308 CAGAAAGCTGTTACAGAAAATGG + Intronic
1046821512 8:118638663-118638685 CAGTAGGATGTTCCAGGAAAGGG - Intergenic
1048688757 8:136934623-136934645 CAGAAATATGTTACAGGAAAGGG - Intergenic
1048692859 8:136988091-136988113 CAGAAGGTGGGTACTGGAAAAGG - Intergenic
1048852470 8:138658089-138658111 CAGAAGGAGGATCCTGGAACAGG + Intronic
1049456554 8:142694346-142694368 CAGAAAGATGTTGCTGGAAGAGG + Intergenic
1049487045 8:142871160-142871182 CTGAAGGATGCTGCTGGTAAGGG + Intronic
1050103989 9:2146500-2146522 CAGAAAGATGTTGCTGAAAAGGG + Intronic
1050926715 9:11273119-11273141 CAGAAGGTCTTTTCTGGAAAGGG - Intergenic
1051038099 9:12774099-12774121 CTGAATGATGTCTCTGGAAATGG + Intergenic
1051225219 9:14892135-14892157 CATAAAGATGTTACAGGAAAGGG - Intronic
1052520896 9:29547635-29547657 CAGAAATATGTTACAGGAAAGGG - Intergenic
1052663872 9:31469798-31469820 CAGAAATATGTTACAGGAAAGGG + Intergenic
1053012705 9:34643928-34643950 CAGAAAGCTGTTCCTGGAATGGG - Intronic
1053076353 9:35137953-35137975 CAGAAATATGTTACAGGAAAGGG + Intergenic
1053600313 9:39603332-39603354 GATGGGGATGTTACTGGAAAAGG - Intergenic
1053857963 9:42357188-42357210 GATGGGGATGTTACTGGAAAAGG - Intergenic
1054253215 9:62739052-62739074 GATGGGGATGTTACTGGAAAAGG + Intergenic
1054567331 9:66773551-66773573 GATGGGGATGTTACTGGAAAAGG + Intergenic
1054796475 9:69306931-69306953 CAGGAAGATGTTACCAGAAAAGG + Intergenic
1055164523 9:73175578-73175600 CAGGAAGATGTTACCAGAAAAGG - Intergenic
1055442653 9:76351959-76351981 CAGAAAGATGCTACTGGAAAGGG + Intronic
1055446678 9:76390883-76390905 CAGATGTGTGTTACTGGCAAAGG + Intronic
1055866623 9:80821880-80821902 CAGAAGTATCATACTGGGAAAGG + Intergenic
1056677333 9:88686604-88686626 CAGGAAGATGTTACTGGAAAGGG - Intergenic
1056728469 9:89142967-89142989 CAGAAAGATGTTACCAGAAATGG + Intronic
1057163602 9:92908708-92908730 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1057557872 9:96101984-96102006 AATAGGGGTGTTACTGGAAAGGG - Intergenic
1057580242 9:96281144-96281166 CAGAAAGATGTTACAGGAAAGGG - Intronic
1058356041 9:104084313-104084335 CAGGAAGATGTTACCAGAAAAGG + Intergenic
1058383330 9:104404086-104404108 CATGAGTATTTTACTGGAAAAGG + Intergenic
1059724133 9:116989476-116989498 CAGATGGAAGGGACTGGAAATGG - Intronic
1059838446 9:118184150-118184172 GAGAAATATGTTACAGGAAAGGG - Intergenic
1060681312 9:125567718-125567740 CAGGAAGATGTTACAGGACAGGG - Intronic
1061362105 9:130150176-130150198 CAGATAATTGTTACTGGAAAGGG + Intergenic
1061588734 9:131584565-131584587 CATAATCATGTTACAGGAAAAGG - Exonic
1061702235 9:132424599-132424621 CAGAGGGAGGTTCCTGGGAAAGG + Intronic
1062251060 9:135593950-135593972 GAGAAGGAAGATACAGGAAAAGG + Intergenic
1186585506 X:10869037-10869059 CAGAGGGATGTGACTAGTAATGG + Intergenic
1186868588 X:13747091-13747113 TAGAAGGATGGTCCTTGAAAAGG + Intronic
1187123502 X:16431959-16431981 CAGAAGGATGATACCAGATATGG - Intergenic
1187149818 X:16671429-16671451 TAGAAAGATGTTACCAGAAACGG - Intronic
1188126522 X:26375024-26375046 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1188481119 X:30637893-30637915 CAGAAGGAAGTTAGGGGGAAAGG + Intergenic
1188679198 X:32980530-32980552 CTGAAGGATGATAGTGGGAATGG - Intronic
1188838932 X:34991179-34991201 TAGAAAGATGTTACCAGAAAGGG + Intergenic
1189094651 X:38125456-38125478 CAGAAAGATGTTGCTGGAAAAGG - Exonic
1189169360 X:38894229-38894251 TAGAAGGATGAAACTGGCAATGG + Intergenic
1189746665 X:44175340-44175362 AAGAATGATGATAGTGGAAATGG + Intronic
1190057317 X:47188721-47188743 GAGGAGGGTGTCACTGGAAAGGG + Intergenic
1190137905 X:47813880-47813902 CAGGAAGATGTTAGTGGAAAGGG + Intergenic
1190244169 X:48679956-48679978 CAGGAAGATGTTACCGGAAAGGG - Intronic
1190368523 X:49719972-49719994 CAGCAGGAAGTTTCTGGAGACGG + Intergenic
1190547162 X:51540372-51540394 ATGAAGGATGTTACAAGAAATGG - Intergenic
1190551720 X:51588992-51589014 ATGAAGGATGTTACAAGAAATGG + Intergenic
1190815952 X:53929215-53929237 GAGAAATATGTTACAGGAAAGGG - Intergenic
1190921051 X:54852598-54852620 CAGAAAGAGGTTACAGGAAAGGG + Intergenic
1190947337 X:55108908-55108930 CAGAAATATGTTACAGGACAGGG - Intronic
1191056056 X:56242335-56242357 CATAAGTTTGTTACTGGAAATGG + Intronic
1191219048 X:57965917-57965939 CAGGAAGATGTTACCAGAAAGGG + Intergenic
1191844936 X:65540076-65540098 CAGAAAGATGTTACAGGAAAGGG - Intergenic
1192542711 X:71988723-71988745 CAGAAAGATGTTACCAGAAAAGG + Intergenic
1192714580 X:73626019-73626041 CAGGAAGATGTTACTAGAAAGGG + Intronic
1192730783 X:73800821-73800843 CAGAAAGATGTTATAGGAAAAGG + Intergenic
1192864543 X:75117194-75117216 CAGAAAGATGTTACTGGAAAGGG - Intronic
1192888396 X:75362241-75362263 CAAGAAGATGTTACTGAAAAGGG - Intergenic
1193705943 X:84820546-84820568 CAAAAAGATGTCACAGGAAAGGG + Intergenic
1193830984 X:86289179-86289201 CAGGAGGAAGGTCCTGGAAAGGG + Intronic
1194438961 X:93905890-93905912 CTGAAGGAGGTTCCTGAAAAAGG - Intergenic
1194932535 X:99904798-99904820 AAGAAGGATGTTTGGGGAAAGGG + Intergenic
1194997871 X:100611427-100611449 TATTAGGGTGTTACTGGAAAGGG - Intergenic
1195666501 X:107436265-107436287 CAGAAGGATGGTATTTTAAAAGG - Intergenic
1195876907 X:109551445-109551467 CAGAAAAATGTTACCAGAAAGGG - Intergenic
1198182229 X:134220975-134220997 CAAAAAGATGTTACCAGAAAGGG + Intergenic
1198389267 X:136157609-136157631 GGGAAGAATGTTACTGGAAAAGG - Intronic
1198440160 X:136655309-136655331 CAGAAGAAAGGTCCTGGAAAGGG - Intronic
1198844934 X:140900359-140900381 CAGAAAGATATTACAGAAAAGGG + Intergenic
1199393647 X:147309461-147309483 CAGAGATATGTTACAGGAAAGGG - Intergenic
1199498266 X:148478611-148478633 CAAAAGGAAGGTAGTGGAAATGG + Intergenic
1199948261 X:152684357-152684379 CGGAAAGATGTTACTGGAATGGG - Intergenic
1199961418 X:152784097-152784119 CGGAAAGATGTTACTGGAATGGG + Intergenic
1200091599 X:153638645-153638667 GAGAAGCATGTTCCTGGAAGGGG + Intergenic
1201406515 Y:13655513-13655535 CAGAAAGATACTAATGGAAAGGG - Intergenic
1202269032 Y:23052872-23052894 CAGAAGAGTGTTAGTGGATATGG + Intergenic
1202349048 Y:23967464-23967486 CGTAAGGAAGTTACTTGAAAAGG + Intergenic
1202422024 Y:24686612-24686634 CAGAAGAGTGTTAGTGGATATGG + Intergenic
1202448762 Y:24983466-24983488 CAGAAGAGTGTTAGTGGATATGG - Intergenic
1202521727 Y:25702640-25702662 CGTAAGGAAGTTACTTGAAAAGG - Intergenic