ID: 1045429205

View in Genome Browser
Species Human (GRCh38)
Location 8:102097544-102097566
Sequence CTGTTTCATCAGAAGTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045429200_1045429205 8 Left 1045429200 8:102097513-102097535 CCAGATCCCTTCCCGGTGAGACA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG No data
1045429204_1045429205 -4 Left 1045429204 8:102097525-102097547 CCGGTGAGACATGTAGATGCTGT 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG No data
1045429201_1045429205 2 Left 1045429201 8:102097519-102097541 CCCTTCCCGGTGAGACATGTAGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG No data
1045429202_1045429205 1 Left 1045429202 8:102097520-102097542 CCTTCCCGGTGAGACATGTAGAT 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG No data
1045429203_1045429205 -3 Left 1045429203 8:102097524-102097546 CCCGGTGAGACATGTAGATGCTG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1045429205 8:102097544-102097566 CTGTTTCATCAGAAGTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045429205 Original CRISPR CTGTTTCATCAGAAGTTGCG TGG Intronic
No off target data available for this crispr