ID: 1045432135

View in Genome Browser
Species Human (GRCh38)
Location 8:102124112-102124134
Sequence GCTCGGTGCGCCGCGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045432135_1045432141 7 Left 1045432135 8:102124112-102124134 CCTGCGCCCGCGGCGCACCGAGC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1045432141 8:102124142-102124164 TCCCCCCCAGCAGCCGCCCCCGG No data
1045432135_1045432149 21 Left 1045432135 8:102124112-102124134 CCTGCGCCCGCGGCGCACCGAGC 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1045432149 8:102124156-102124178 CGCCCCCGGCACACCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045432135 Original CRISPR GCTCGGTGCGCCGCGGGCGC AGG (reversed) Intronic
900119238 1:1041527-1041549 TCTCAGGGCGCCGCGTGCGCGGG - Exonic
901084563 1:6602724-6602746 GCTCGGCGCGCAGCTGGCTCAGG + Exonic
901540075 1:9910040-9910062 GCGCGGCGCGGCGCGGGCCCGGG + Intronic
902600903 1:17539730-17539752 CCTCGGAGCGCGGCGGGCGCGGG + Intergenic
903788281 1:25875503-25875525 GCTGGGAGGGCCGCGGGGGCCGG + Intergenic
903883720 1:26529630-26529652 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
904779746 1:32936887-32936909 GCTCGGTGCACCTTGGGCTCTGG + Exonic
904942770 1:34176895-34176917 GCTCGGTGCGCGGGGCGCCCTGG - Intronic
905670702 1:39788583-39788605 GCTCGGCGGGCGGCGGGCGGCGG + Exonic
905867064 1:41382225-41382247 GCTGGGTGCGCCGGGGGAGCTGG + Exonic
906306728 1:44724462-44724484 GCTCCGTGCGCCGGGTGGGCGGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
910657515 1:89633379-89633401 GCTCGGTCCGCTGTGCGCGCCGG + Intronic
912471548 1:109910535-109910557 GGTCGGTCCGCAGAGGGCGCGGG + Intronic
915238367 1:154502131-154502153 GCTCGGGGCGCCGAGCGGGCGGG + Intergenic
915463186 1:156081730-156081752 GCCGGGGGCGCCGCGGGCGGCGG + Exonic
918001642 1:180502597-180502619 GCGCGGGGCGCGGCTGGCGCTGG + Exonic
919712264 1:200739540-200739562 GCTCGGAGGGGCGCGGGCACGGG + Exonic
920508149 1:206531530-206531552 GGTCTGTGCGCAGAGGGCGCTGG + Intronic
924715159 1:246566444-246566466 GCTCTATGCTCCGCGGTCGCGGG + Exonic
1064380507 10:14837978-14838000 GCTTGGTGGGCGGTGGGCGCGGG - Exonic
1065100380 10:22325599-22325621 GGGCGGCGCGCCGCGGGGGCGGG - Intronic
1066046996 10:31603337-31603359 GCGGGGTGCGCCCGGGGCGCTGG - Intergenic
1072102207 10:92239824-92239846 GCCGGCTGCGGCGCGGGCGCAGG + Exonic
1074618441 10:115093336-115093358 GCTCCGAGCGCCGCGCGCCCAGG - Intergenic
1075119349 10:119652266-119652288 GCAGGGTGCGCCGCGGGTCCCGG - Intronic
1076394550 10:130129197-130129219 CCTGGGTGCGGCGTGGGCGCGGG - Intergenic
1077194444 11:1272285-1272307 GGCCGGGGCGCCGCGGGTGCCGG - Intergenic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077415502 11:2422622-2422644 CCTCAGTGAGCCGAGGGCGCTGG + Intronic
1078057410 11:8019264-8019286 GCTCGGGGCTCCGCGGGCGGCGG - Intronic
1083939569 11:65888426-65888448 GCTCGGGGCGCTGCGGCCCCGGG - Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089398862 11:118153037-118153059 GCAGGGTGCGCAGCGGGCGGGGG - Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1091550322 12:1531073-1531095 GGTCTGCGCGCCGCGGGCGTCGG + Intronic
1096024825 12:48351138-48351160 GCTTGGAGGGCGGCGGGCGCCGG + Intronic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1096460907 12:51821129-51821151 GGACGGTCCGCGGCGGGCGCAGG + Intergenic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096647594 12:53047191-53047213 GCGCGGGGCGCGGCGGGGGCGGG + Intronic
1096647743 12:53047621-53047643 GCCCCGTGCGCCCCGGGTGCTGG - Intronic
1096673306 12:53213145-53213167 GCTGGCTGGGCCGCCGGCGCCGG + Exonic
1101773826 12:107775762-107775784 GCGCGCTGTGCGGCGGGCGCGGG - Exonic
1102924923 12:116819371-116819393 GCTCTGCGCGCCGCCGGCTCCGG - Intronic
1103348352 12:120265760-120265782 GCGGGGCGCGCGGCGGGCGCGGG - Exonic
1103488228 12:121296858-121296880 GGGCGGTGCGCGGCGGGCGCGGG - Intronic
1103809498 12:123602208-123602230 GCTGGGCGCGCTGCGGGAGCTGG + Exonic
1104444718 12:128823880-128823902 GCTGGGCGCGCGGCGGGCGGCGG - Exonic
1104983387 12:132583618-132583640 GGGCGGTGCGCCGAGGGCGGCGG - Exonic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1105525700 13:21176321-21176343 GTGGGGTGCGCCGCGGGCGGAGG - Intronic
1105578475 13:21673861-21673883 GCTAAGTGCGCCGCGGGGCCCGG - Intronic
1105800967 13:23903296-23903318 GCTCGGTGCACCGCGGCATCTGG - Intergenic
1108542044 13:51453569-51453591 ACTCGGGGCCTCGCGGGCGCCGG + Intronic
1113655769 13:112067158-112067180 GGGCGGCGCGCCGCGTGCGCTGG - Intergenic
1113779722 13:112969174-112969196 GCGCGCTGCGCCGCGGGGGGCGG - Intronic
1114516167 14:23301618-23301640 GGTCGGCGCGCGGCGGGGGCGGG + Exonic
1115610706 14:35046380-35046402 GCGCGGCGCGAGGCGGGCGCTGG + Intronic
1118285259 14:64465367-64465389 GCGCGGGGCGGCGCGGGCGCCGG - Intronic
1118992643 14:70809729-70809751 GCACGGTGCGACGGCGGCGCAGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122226837 14:100285392-100285414 GCAGGGTGCGCCGCCGCCGCCGG + Intergenic
1122418224 14:101560515-101560537 GCGCGGGGCGCCACGGGCGTGGG - Intergenic
1122603696 14:102933778-102933800 GCTCGGTGGGCCGCTGGGGTTGG + Exonic
1122697412 14:103562776-103562798 CCTCGCTGCGCCGCTGGCGGTGG - Intronic
1123036714 14:105474688-105474710 CCTGGGGGCGCCGCGGGGGCGGG - Intronic
1124612066 15:31215747-31215769 GCTCGGGGCGGCGGGGGCCCGGG - Intergenic
1125608468 15:40955666-40955688 GCTCTGTGGGCCTCAGGCGCAGG + Exonic
1127753591 15:62068504-62068526 GCGCGGTGCCCGGCGGCCGCAGG - Exonic
1128322256 15:66702097-66702119 GCTCGGCCCGCCCCGGGAGCCGG + Intergenic
1129162052 15:73752661-73752683 GCTCCGGACGCCGCGGGTGCCGG - Exonic
1130076574 15:80695231-80695253 GCTCCGAGCGCCGCGCCCGCCGG + Intronic
1131977475 15:97960874-97960896 GCTGGGTGCGCGGCGGCCGTGGG + Exonic
1132765923 16:1534142-1534164 CCTCGGGGCGGCGCGGGCGGAGG - Exonic
1133097686 16:3458324-3458346 GGACCGTGCGCCGGGGGCGCGGG - Intronic
1135335738 16:21599693-21599715 GCTCGGATCACCGCCGGCGCCGG - Exonic
1138619154 16:58197907-58197929 GCTGGGGGCGCGGGGGGCGCCGG + Exonic
1141463342 16:84191369-84191391 GCGCGATACGTCGCGGGCGCGGG - Exonic
1142139918 16:88468267-88468289 GCTCTGTGCGCCGCAGGCAGTGG - Intronic
1142144336 16:88486576-88486598 GCTAGGTGCACCATGGGCGCTGG + Intronic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1143750324 17:9022432-9022454 GCGCGGTGCGCGGCGGGCCCGGG + Exonic
1144853132 17:18254130-18254152 GCTGGGTGCTCCGCAGGTGCAGG + Exonic
1145041279 17:19579891-19579913 GCTGGCGGCGGCGCGGGCGCGGG - Intergenic
1145787859 17:27605627-27605649 GCCGGGTGCACCGCGGCCGCTGG + Exonic
1147015674 17:37489830-37489852 GCGCGGCCCGCCCCGGGCGCGGG + Exonic
1148323722 17:46771754-46771776 GCGCGGCGCGGCGCGGGGGCGGG - Intronic
1149806125 17:59619794-59619816 GCGCCGCGCGCGGCGGGCGCAGG - Intronic
1150002698 17:61451754-61451776 GCCCAGGGGGCCGCGGGCGCTGG - Intergenic
1150398133 17:64836884-64836906 GGTCGGAGCGGAGCGGGCGCGGG + Intergenic
1151767577 17:76140221-76140243 GGTCGGTGCCCCCCGGGGGCAGG + Exonic
1152744268 17:82031853-82031875 GCTCGGGGCGCAGCCGGGGCGGG + Intronic
1152922894 17:83074562-83074584 GCTGGGTGTGCCGACGGCGCTGG + Intergenic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1160788701 19:913052-913074 GGGCGGGGCGCGGCGGGCGCCGG - Intronic
1160861318 19:1238222-1238244 CCGAGGTGCGCCGCGTGCGCAGG + Intergenic
1160967706 19:1753846-1753868 GGTGGGGGCGCCGGGGGCGCGGG + Exonic
1161400899 19:4065921-4065943 GCGCGGCGCGGCGCGGGGGCGGG - Intronic
1161573326 19:5041944-5041966 GCTCTCTGAGCCGAGGGCGCCGG + Intronic
1162100332 19:8335070-8335092 GCTCGGTGAGCCGCCGCAGCTGG + Exonic
1162341933 19:10096500-10096522 GCTGGGCGCGTCGTGGGCGCGGG - Exonic
1162733793 19:12734593-12734615 GCTCCGGGCCCCGCGGGCGGTGG - Exonic
1163117301 19:15196176-15196198 GCTCCGGGCGCCGCGCGCGCCGG + Intronic
1163830640 19:19545654-19545676 GCTGGGTCCTCCGCGGGCACCGG - Exonic
1165305485 19:35000445-35000467 GGTGGGCGCGCCCCGGGCGCAGG - Exonic
1165461114 19:35944933-35944955 GCCCTGAGCGCCGCGGGCTCCGG - Exonic
1166042940 19:40214135-40214157 GCGCTGTGAGCCGCGGGCACCGG + Exonic
1166677277 19:44747855-44747877 CCCCGGTGCCCCGCGGGCCCCGG + Intronic
1166765603 19:45251161-45251183 GGTCGGGGCGCCGGGGGCTCCGG - Intronic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1168307264 19:55442412-55442434 GCTGGGGGCGCCGGGGGCGCTGG - Exonic
926581304 2:14634391-14634413 GCCCAGTGCGGGGCGGGCGCGGG - Exonic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
928904815 2:36356942-36356964 GGTGGGGGCGCCGCGGGCGGGGG + Intronic
929795664 2:45056659-45056681 GCTCTGTGCGCTGAGGGCCCTGG + Intergenic
930096572 2:47570671-47570693 GCCCGGGGCCCCGCGGACGCCGG - Exonic
931779055 2:65564305-65564327 GCTCAGTGCGCCGAGGTTGCAGG - Intergenic
933893303 2:86789937-86789959 GCTCTGGGCGCCGGGTGCGCTGG - Intronic
934993269 2:98936157-98936179 GCTGGGAGCGCGCCGGGCGCAGG - Exonic
935137651 2:100321814-100321836 GCTCGGGGCGCTGCGGCCGGAGG - Exonic
939869042 2:147507005-147507027 GCACTCTGAGCCGCGGGCGCCGG + Intergenic
946313003 2:218893166-218893188 GCTCGCTGCGCGTCTGGCGCAGG - Exonic
946322235 2:218960818-218960840 GCTCGGTGGGCCCCCGCCGCTGG - Exonic
947156050 2:227164161-227164183 ACGCGGACCGCCGCGGGCGCGGG + Intergenic
948116020 2:235494610-235494632 GCTCGGCGGCCCGCGGGCCCCGG + Exonic
1170150326 20:13221152-13221174 GCTCGGGGCGGCGAGGGCGGGGG + Intergenic
1171011996 20:21513943-21513965 GCGCCGAGCGCCGCGGGCCCCGG + Exonic
1171034283 20:21703721-21703743 GCTCGGGGCTCCGGGGGTGCGGG - Intergenic
1171977614 20:31605514-31605536 TCGCGCTGCGCCGGGGGCGCCGG + Exonic
1172245609 20:33443443-33443465 GCCCGGCGCTCCGCGGGAGCAGG - Exonic
1174053786 20:47785043-47785065 GCTCGGTGTGCCGTGTCCGCGGG + Intronic
1174386597 20:50191276-50191298 GCTGGGCGCGCCGCAGGCCCCGG + Exonic
1175215902 20:57391597-57391619 GCGCCGTGCGCCCCGAGCGCGGG + Exonic
1175394576 20:58649985-58650007 CCTGGGTGAGCCGCGGGCACCGG + Intergenic
1175902942 20:62367137-62367159 GCTGGGCGCGGCGCGGGCGCGGG - Exonic
1176194249 20:63830408-63830430 GCTCGGGGCGCGGAGGGCTCGGG - Intronic
1176194811 20:63831974-63831996 GATCGGCGCACCTCGGGCGCAGG + Intergenic
1178314522 21:31557933-31557955 GCGCCGTGCGCGGCGGGGGCTGG + Intronic
1179150691 21:38806037-38806059 GCTCGGTGCGCGCCGGGCGAGGG - Exonic
1179411969 21:41168769-41168791 CCTCAGTGCGCCCCGGGCGGGGG - Intronic
1180951579 22:19722885-19722907 GCTGGGTGACCCGCGGGAGCAGG - Exonic
1180960681 22:19761034-19761056 GCCCGGGGCGCCGGGGGCGGCGG - Exonic
1181653085 22:24271484-24271506 GTTCCGTCCGCCTCGGGCGCCGG - Intronic
1181831669 22:25564954-25564976 GGTCGGGGCGCGGCGGGCGGCGG + Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1183546226 22:38455860-38455882 TCTCGGCGCGCCGCGGGCGGCGG - Intergenic
1184035019 22:41914142-41914164 TCACTGTGCGCCGCGCGCGCGGG + Exonic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184276555 22:43412173-43412195 GGGCGGGGCGCGGCGGGCGCGGG + Intronic
1184594131 22:45503732-45503754 GCTCGGTGCTCAGCGGGGACTGG + Intronic
1184597900 22:45525492-45525514 GCTCTGTGCGCAGGGGGCCCAGG - Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
1185398546 22:50604557-50604579 GGTCGAGGCGCGGCGGGCGCGGG - Exonic
949414275 3:3799440-3799462 GCGGGGCGCACCGCGGGCGCCGG + Exonic
953925373 3:46979940-46979962 GCTGGGGGCACCGCGGGTGCGGG - Intronic
954186331 3:48919426-48919448 CCTAGGGGCGCCGCGGGCTCCGG - Intronic
961081739 3:124033653-124033675 GCCCGGTGGGCGGAGGGCGCGGG - Intergenic
962750999 3:138434815-138434837 GCTGGGGGCCCCGGGGGCGCAGG - Exonic
962751015 3:138434849-138434871 GCTCGGGGCCCGGCGTGCGCTGG - Exonic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
968756123 4:2417476-2417498 GCTAGGAGAGGCGCGGGCGCCGG + Intronic
969330868 4:6472762-6472784 GCTGGGTGCGCCACGGGGGAGGG + Intronic
972321704 4:37977850-37977872 GCTCGGTGCCTCCCCGGCGCGGG + Intronic
975661050 4:76689453-76689475 GCGCGGCGCGCCGAGGGTGCGGG - Intronic
981782877 4:148445545-148445567 GCGCGGCGCGCCGCGAGCGGAGG - Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
985515846 5:344172-344194 GCTCAGGGCCCCGAGGGCGCAGG - Intronic
986152494 5:5140304-5140326 GCTCCGTGCGGCGCGGGGGGCGG - Intergenic
986330615 5:6713912-6713934 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
991351108 5:65721836-65721858 GCCCGGTGTGCAGCGGGTGCCGG + Intronic
997253674 5:132410827-132410849 GCGGGGCGCGCGGCGGGCGCGGG - Intronic
997282183 5:132656247-132656269 GCTCGGGGAGCCGCTGGCCCGGG + Intronic
997899953 5:137754834-137754856 GCTCTGCACGCCGGGGGCGCCGG - Intergenic
998130466 5:139648933-139648955 GTTCGGTGCGCGGCCGGGGCCGG + Intronic
998406270 5:141876367-141876389 GCCCGCTGCGCCGCTCGCGCCGG - Intronic
1001529871 5:172454360-172454382 GCTCGGCCCGCTGCGGGCGGAGG - Exonic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1002046244 5:176543217-176543239 GCGCCGAGCGCCCCGGGCGCAGG - Intronic
1003049335 6:2765770-2765792 GCGCGGTGCGACCCGGCCGCGGG - Exonic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1013619385 6:111873161-111873183 GGGCGGTGCGGCGCGGGCGGCGG + Exonic
1014230288 6:118894978-118895000 GCGCCGTGCGCCGGGGTCGCTGG - Intronic
1017672519 6:156779630-156779652 GGTCGGGGCGCCCCGGGGGCCGG + Intronic
1017764795 6:157597764-157597786 GCTCGGTGCCCCCCAGGGGCTGG - Intronic
1019197244 6:170289920-170289942 GCTCGCTGCACGGCCGGCGCTGG + Intronic
1019343648 7:519702-519724 CCTCGCTGCGCCGCCCGCGCGGG + Intronic
1021845270 7:24757374-24757396 GGTAAGTGCGCGGCGGGCGCGGG - Intronic
1030033167 7:105387979-105388001 CTTGGGTGCGCTGCGGGCGCCGG - Intronic
1033165573 7:139036034-139036056 GCTCGCTGCGCCGCGCGCACAGG - Intergenic
1034911672 7:155002987-155003009 GCGCCGGGCGCCGCGGGGGCCGG - Exonic
1036708034 8:11059612-11059634 GCTGGGGGCGCGGGGGGCGCGGG + Intronic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1049354522 8:142181076-142181098 ACTCGCTGAGCCGCGAGCGCTGG + Intergenic
1049419486 8:142510588-142510610 GCTGGGGGCGGCGGGGGCGCGGG + Intronic
1049694549 8:143976960-143976982 GCCCCGTGCGCCGGGGGCTCAGG - Intergenic
1049784604 8:144444415-144444437 GCTCGGATCGCCGCGGGATCCGG + Exonic
1050512969 9:6413721-6413743 GCTCTGTGCGCCGCGCGCGCAGG + Intronic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1055574358 9:77647334-77647356 GCTGGGTGTGCTGCGGGCGGAGG + Intronic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1056243067 9:84668720-84668742 GCTCCGGGCAGCGCGGGCGCAGG + Intronic
1057360865 9:94372930-94372952 GCTCGGTGAGCCGAGGGGGGCGG + Intergenic
1062341121 9:136094472-136094494 GCGGGGTGCGCGGCGGGCCCCGG + Intronic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1185605681 X:1366522-1366544 GCCCGGTGAGCCGGGTGCGCGGG + Intronic
1185605824 X:1366961-1366983 GCGGGGTGCGCCGGGTGCGCGGG + Intronic
1185605917 X:1367240-1367262 GCGGGGTGCGCCGGGTGCGCGGG + Intronic
1185606020 X:1367555-1367577 GCGGGGTGCGCCGGGTGCGCGGG + Intronic
1187900905 X:24025748-24025770 ACGCGGGGCGCCGCGGGCGCGGG - Intronic