ID: 1045432152

View in Genome Browser
Species Human (GRCh38)
Location 8:102124160-102124182
Sequence GCAGCCGGGGCGGGTGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045432152_1045432164 14 Left 1045432152 8:102124160-102124182 CCCGGCACACCCGCCCCGGCTGC No data
Right 1045432164 8:102124197-102124219 TCTGGCTCCCGAGAAGCGGAGGG No data
1045432152_1045432165 18 Left 1045432152 8:102124160-102124182 CCCGGCACACCCGCCCCGGCTGC No data
Right 1045432165 8:102124201-102124223 GCTCCCGAGAAGCGGAGGGAAGG No data
1045432152_1045432162 10 Left 1045432152 8:102124160-102124182 CCCGGCACACCCGCCCCGGCTGC No data
Right 1045432162 8:102124193-102124215 CCGCTCTGGCTCCCGAGAAGCGG No data
1045432152_1045432159 -4 Left 1045432152 8:102124160-102124182 CCCGGCACACCCGCCCCGGCTGC No data
Right 1045432159 8:102124179-102124201 CTGCAACTCCGACTCCGCTCTGG No data
1045432152_1045432163 13 Left 1045432152 8:102124160-102124182 CCCGGCACACCCGCCCCGGCTGC No data
Right 1045432163 8:102124196-102124218 CTCTGGCTCCCGAGAAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045432152 Original CRISPR GCAGCCGGGGCGGGTGTGCC GGG (reversed) Intronic