ID: 1045439028

View in Genome Browser
Species Human (GRCh38)
Location 8:102191684-102191706
Sequence GATAAGAGGCAGAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045439028_1045439031 7 Left 1045439028 8:102191684-102191706 CCTTCCAACTTCTGCCTCTTATC No data
Right 1045439031 8:102191714-102191736 ATAGCTGCTTCCACATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045439028 Original CRISPR GATAAGAGGCAGAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr