ID: 1045440605

View in Genome Browser
Species Human (GRCh38)
Location 8:102205217-102205239
Sequence CAGTATCTACAAATGAAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045440601_1045440605 28 Left 1045440601 8:102205166-102205188 CCATCTGCAGCTTTATCATTAAA 0: 2
1: 0
2: 2
3: 22
4: 309
Right 1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG 0: 1
1: 1
2: 0
3: 21
4: 364
1045440602_1045440605 -3 Left 1045440602 8:102205197-102205219 CCTGACATTAGCCCTTAGTTCAG 0: 1
1: 0
2: 2
3: 3
4: 60
Right 1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG 0: 1
1: 1
2: 0
3: 21
4: 364
1045440600_1045440605 29 Left 1045440600 8:102205165-102205187 CCCATCTGCAGCTTTATCATTAA 0: 2
1: 0
2: 0
3: 21
4: 200
Right 1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG 0: 1
1: 1
2: 0
3: 21
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045440605 Original CRISPR CAGTATCTACAAATGAAATT TGG Exonic
901244350 1:7717317-7717339 CACTATGTACAAATGTACTTTGG - Intronic
901438090 1:9261752-9261774 CAGTATCTACAGAGGCAATCTGG + Intronic
902352337 1:15866198-15866220 CTTTTTCTAAAAATGAAATTAGG + Intronic
905288310 1:36902155-36902177 CTGTATCTATAAATCAATTTGGG - Intronic
905473410 1:38209308-38209330 CAGTCTCTTCATGTGAAATTGGG - Intergenic
905702339 1:40026946-40026968 CAGTATCAACATATGAATCTTGG - Intergenic
906784869 1:48606398-48606420 CAGTCTCTAAAAATGAAAGAAGG + Intronic
907028211 1:51143468-51143490 CAGTACCTACTAACTAAATTTGG - Intronic
907599537 1:55753133-55753155 CTGTATCAACAAACAAAATTTGG - Intergenic
907775071 1:57506290-57506312 AAGTATTTAAAAATGAAACTTGG + Intronic
908162121 1:61420805-61420827 CAGTGTTTAGAATTGAAATTTGG + Intronic
908485106 1:64584032-64584054 CACTATCTAAAAATAAAATGAGG + Intronic
908568505 1:65383939-65383961 AAATATATACAAATCAAATTGGG + Intronic
909311445 1:74155120-74155142 CAGAAGATAGAAATGAAATTTGG - Intronic
909312116 1:74164955-74164977 CAATATGTCCAAATGAATTTTGG - Intronic
909768204 1:79385361-79385383 CAGTAAATACCAATGCAATTGGG - Intergenic
910164946 1:84316982-84317004 AACTATCTGCAAAGGAAATTAGG - Intronic
911518961 1:98905747-98905769 CAGTAACTAGAGATCAAATTAGG - Intronic
912596620 1:110885248-110885270 CAGTATCTATTAAAGAGATTTGG + Intronic
912740804 1:112195139-112195161 CTGTATCTATTAAAGAAATTTGG + Intergenic
913116889 1:115705540-115705562 CAGTTTTCACAAATGAAGTTTGG - Intronic
913743132 1:121871468-121871490 CAGAATCTGCAAGTGACATTTGG - Intergenic
913973256 1:143432880-143432902 AAGTTTCCACATATGAAATTTGG - Intergenic
914067642 1:144258487-144258509 AAGTTTCCACATATGAAATTTGG - Intergenic
914111513 1:144707867-144707889 AAGTTTCCACATATGAAATTTGG + Intergenic
915687373 1:157647633-157647655 CAGAATCTACAAATTCACTTGGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
916998211 1:170324994-170325016 CAGTGTTCACATATGAAATTTGG + Intergenic
917572088 1:176277936-176277958 CTGTATCTATATATCAAATTAGG + Intergenic
918352779 1:183674912-183674934 CAGTATCTTCAAAAGTAATTAGG + Intronic
919503843 1:198372745-198372767 TAGTGTCTACAAATGATAGTTGG + Intergenic
920072329 1:203311377-203311399 CAGAAGCTACAAATAAAAATGGG - Intergenic
920405977 1:205711242-205711264 TAGTATCTAAAAATGAGATGGGG + Intergenic
920809562 1:209269666-209269688 CAGTATGTAAAAATGAAAATTGG - Intergenic
920891272 1:209987842-209987864 CATTATCTACAAAAGAAAAGAGG - Intronic
920960236 1:210657011-210657033 CAACATTTACAAATGATATTTGG - Intronic
920999015 1:211024000-211024022 CAGTATGTAATGATGAAATTGGG - Intronic
923872224 1:238007980-238008002 CAGTATTTAAAAAGGAAACTAGG - Intergenic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1062770872 10:99566-99588 CAGTATCTACTTCTGAAGTTGGG + Intergenic
1063341186 10:5264897-5264919 TAAAATCTAAAAATGAAATTTGG - Intergenic
1063694251 10:8317498-8317520 CAGTATCCTCAATTTAAATTTGG - Intergenic
1063947043 10:11187857-11187879 AAATATCTATAAAAGAAATTTGG - Intronic
1065658748 10:27982754-27982776 CAGTATCTTCAACATAAATTTGG - Intronic
1066539053 10:36424523-36424545 CTGTTTCTGCAAATGAAATGTGG - Intergenic
1067572105 10:47379200-47379222 TAGTATTAACAAATGAAATAAGG + Intronic
1067843128 10:49697851-49697873 AATTATCTTTAAATGAAATTTGG + Intronic
1068048106 10:51913226-51913248 CTGTATCTAAAATAGAAATTGGG - Intronic
1068054220 10:51991115-51991137 AAGTATCTGAAAATGAAATGAGG - Intronic
1068315742 10:55339201-55339223 CAGTATGTAATAATTAAATTAGG - Intronic
1070260241 10:74847814-74847836 CGGGATCCACAAATGAACTTGGG + Intronic
1070687428 10:78498770-78498792 AACAATCTAAAAATGAAATTAGG - Intergenic
1071047112 10:81393699-81393721 CAGAATCTACAGATCACATTGGG + Intergenic
1071605917 10:86989215-86989237 CAATAGCTACAAATAAAATGAGG - Intergenic
1072945020 10:99801987-99802009 CAGTATCTCCAGAAGAAATAAGG - Intronic
1073997119 10:109328322-109328344 CATTATTTACACATAAAATTTGG + Intergenic
1074392480 10:113069621-113069643 CATTATTTAGAAATGGAATTGGG + Intronic
1078647433 11:13154197-13154219 CAGTAACTATATATGAACTTGGG + Intergenic
1079505906 11:21151574-21151596 CAGTTTCCACATCTGAAATTTGG + Intronic
1080330118 11:31127126-31127148 CAGTTTCTAAAAATAACATTTGG - Intronic
1080356613 11:31454550-31454572 CATTGTATAAAAATGAAATTAGG - Intronic
1081189469 11:40085133-40085155 CTGTATCTGCAAATAAAATTGGG + Intergenic
1082152375 11:48757099-48757121 TAGTATCTGCAAAGGATATTTGG - Intergenic
1082297525 11:50460441-50460463 TAGTATCTGCAAATGATTTTTGG + Intergenic
1082601521 11:55163011-55163033 TAGTATCTGCAAAGGATATTTGG - Intergenic
1085568331 11:77536514-77536536 AAGTATCTGGAAAGGAAATTAGG + Intronic
1088339667 11:108748962-108748984 CAGTATTTAAAAATGAGTTTAGG - Intronic
1088925696 11:114299060-114299082 TAGTATCTGCAAATAAAAATAGG + Intronic
1090996564 11:131871311-131871333 GAATAGCTACAAATGAAAATAGG - Intronic
1093551465 12:20417374-20417396 CAGTATCTAAAGATATAATTGGG - Intronic
1093659012 12:21732720-21732742 CAGTTTCAACACATGAATTTTGG - Intronic
1093792441 12:23268348-23268370 CATTATCAACAAATGAAGTTTGG + Intergenic
1095428775 12:42110271-42110293 CAGTATCTTGAAATGCATTTAGG - Intronic
1097831358 12:64227532-64227554 CAAAATCAACAAATGAAAATTGG - Intergenic
1099194518 12:79599522-79599544 CAGTATCAACAAATGTGGTTTGG - Intronic
1100580326 12:95933041-95933063 CATTAACTACAGATGAAATAAGG + Intronic
1103111957 12:118288288-118288310 CAGTTTCTACATATGAATTGGGG - Intronic
1103160883 12:118728280-118728302 CAGTTACTACAAAGGAAATTGGG + Intergenic
1104864997 12:131948347-131948369 CAGTAACTGCAAATGAATGTGGG - Intergenic
1105994561 13:25657842-25657864 CAGTTGCTACAAATGAAACCTGG + Intronic
1106298863 13:28444137-28444159 CACTATCTACTATTGAAAGTGGG - Intronic
1107247199 13:38310516-38310538 CAGTTTCAACATATGAATTTAGG + Intergenic
1107341326 13:39409737-39409759 CAGTAATTACAAATGTCATTTGG + Intronic
1107342263 13:39420543-39420565 CAGTATCTACAAATCAGTTCTGG - Intronic
1107727992 13:43319329-43319351 CAGTATCTACAATAGAATTCTGG - Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1110034199 13:70658382-70658404 AACTTTCTACAAATAAAATTAGG + Intergenic
1111429167 13:88129546-88129568 CATTTTCTAGAGATGAAATTTGG + Intergenic
1111558258 13:89909999-89910021 CTGTATCTATAAATCAATTTTGG + Intergenic
1112591433 13:100766890-100766912 CAGTTTTTAAAAATGAAAATGGG + Intergenic
1116320098 14:43450998-43451020 CCATATCTTCAAATCAAATTTGG - Intergenic
1119611694 14:76068755-76068777 CAGTCTCTACAAGTGACTTTGGG + Intronic
1120637404 14:86969056-86969078 CAGCATCTGCAAAGGAAAGTGGG - Intergenic
1120644034 14:87050753-87050775 CAATATCTGCAAAAGAAATGGGG - Intergenic
1123672564 15:22674145-22674167 CAGTGTCAACATATGAATTTTGG + Intergenic
1124188390 15:27550133-27550155 CACTCTGTACAAATGAGATTAGG + Intergenic
1124324614 15:28747434-28747456 CAGTGTCAACATATGAATTTTGG + Intergenic
1124500025 15:30220048-30220070 CATTATCTACCAAAGAAATCAGG - Intergenic
1124743552 15:32318618-32318640 CATTATCTACCAAAGAAATCAGG + Intergenic
1124819518 15:33030742-33030764 CATTTTCTACACCTGAAATTAGG - Intronic
1124857851 15:33408024-33408046 CAGAATCTAAAAATGAAAACTGG - Intronic
1125295397 15:38197497-38197519 CAGTACCTACAAGTTAAACTTGG - Intergenic
1126373051 15:47967208-47967230 AATTATCAAGAAATGAAATTCGG + Intergenic
1127098813 15:55541960-55541982 CACTATTTACAAATGAACTTAGG + Exonic
1128301600 15:66569620-66569642 AAGTTTCAACATATGAAATTCGG - Intergenic
1129289067 15:74549383-74549405 CAGTATCTACCAAGAAAAGTAGG - Intronic
1129996150 15:80008022-80008044 AAGTGGCTCCAAATGAAATTCGG + Intergenic
1131764285 15:95658704-95658726 CACCATCCACAAATGTAATTTGG + Intergenic
1131819379 15:96256733-96256755 CAGTCTCTTCAAGTGAAATCAGG + Intergenic
1131999868 15:98167660-98167682 CAGAAGTCACAAATGAAATTAGG + Intergenic
1134374306 16:13656656-13656678 CAGCTTCTACAAAGGACATTTGG + Intergenic
1134879263 16:17730371-17730393 CATTATCTATAAAAGCAATTCGG - Intergenic
1135684064 16:24483666-24483688 CAGTTTCAACATATGAATTTTGG + Intergenic
1137002120 16:35238302-35238324 CAGTATCAACATATGAATTTTGG - Intergenic
1137018437 16:35398464-35398486 CAGTGTCAACATATGAATTTTGG - Intergenic
1137853120 16:51766131-51766153 CAGTACCTATAAATGAGAATTGG - Intergenic
1137906591 16:52328950-52328972 CTATATTTATAAATGAAATTAGG + Intergenic
1139241794 16:65400216-65400238 CAGTATATATAAATTAAAATGGG - Intergenic
1140340855 16:74159489-74159511 AAGGATCTAAAAAAGAAATTGGG + Intergenic
1140608367 16:76568169-76568191 CAGTATCAGCACATGAAATAAGG - Intronic
1140613758 16:76634332-76634354 CAATATCTACTAACCAAATTAGG - Intronic
1141929813 16:87194709-87194731 AAATATCTAGAACTGAAATTGGG + Intronic
1142915827 17:3136813-3136835 CAGTAACATCAAATGAAATTAGG - Intergenic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1143244427 17:5470942-5470964 CAGTATCTACATATGAAAGCTGG - Intergenic
1144266393 17:13573723-13573745 CAGTTTCAACATATGAATTTGGG - Intronic
1145432689 17:22990882-22990904 CAGGATCTACAAATTTATTTTGG + Intergenic
1147391282 17:40110873-40110895 CAGTCTCTATTAATGAGATTTGG + Intergenic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149366309 17:55948536-55948558 TTGTATCTACAAATTACATTGGG + Intergenic
1149428634 17:56578879-56578901 CAGTGCCTACAACTGCAATTAGG - Intergenic
1150115592 17:62546181-62546203 CTGTCTCTACAAAAGAAATTAGG - Intronic
1150708802 17:67512187-67512209 CAGTTTCTTCAAATGAAAACCGG + Intronic
1155069389 18:22300510-22300532 CAGTATTTTCAAATGGAATTTGG + Intergenic
1155518645 18:26647603-26647625 CAGTCTGCACAAATGAAGTTTGG - Intronic
1155548673 18:26941413-26941435 CAGTTTCCAAAAATTAAATTAGG + Intronic
1155907701 18:31472125-31472147 TAGTTTCTACAAATGAAACTTGG - Intronic
1156262061 18:35453747-35453769 CATGATCTGAAAATGAAATTAGG + Intronic
1156321395 18:36027785-36027807 CAGCATTTAGAAATGAAATCTGG - Intronic
1157171479 18:45410397-45410419 CATTATCAAAAAATTAAATTAGG + Intronic
1158370269 18:56794026-56794048 CAGTCTCTAAAATTGTAATTTGG - Intronic
1159460582 18:68717839-68717861 AAGTTTCAACATATGAAATTTGG - Intronic
1160287069 18:77553543-77553565 AAGTTTCTATAAATCAAATTTGG - Intergenic
1160744771 19:705676-705698 CAGTATTTAAAAAAAAAATTGGG + Intergenic
1162584096 19:11548535-11548557 CTGTCTCTAAAAATGAAAATGGG + Intronic
1164348721 19:27303759-27303781 TAGTATCTACAAAGGATATTTGG + Intergenic
1164357319 19:27453674-27453696 TAGTATCTAAAAAAGATATTTGG + Intergenic
1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG + Intronic
1168676660 19:58283344-58283366 TACTATCAACACATGAAATTTGG - Intronic
925643952 2:6016804-6016826 AAAGAACTACAAATGAAATTAGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
927980572 2:27372196-27372218 CAGTTTCTACAACTGAAAGATGG + Intronic
928635030 2:33236466-33236488 CAGCATTTGCAAATCAAATTGGG + Intronic
929236696 2:39612609-39612631 CAGTTTCAACATATGAATTTTGG + Intergenic
929897120 2:45970632-45970654 CAGAAACTACAAAGGAAACTTGG + Intronic
930160524 2:48151313-48151335 CAGTGTCAACAACTGCAATTTGG - Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931697895 2:64885416-64885438 CAGTTTCAACATATGAATTTTGG + Intergenic
931907773 2:66861279-66861301 GAGCATCTACAATTTAAATTAGG + Intergenic
931943776 2:67282635-67282657 CAGTAACCACAAAGGACATTTGG - Intergenic
932343499 2:70981091-70981113 CAGTGTCTTCAACTGAAACTTGG + Intronic
932507485 2:72249662-72249684 CAGTATCTACAAAAGTCATATGG + Intronic
932639291 2:73426869-73426891 AAGTATTTTCAAATAAAATTTGG - Intronic
933358567 2:81247497-81247519 CATTATCTAAAAATCAACTTTGG + Intergenic
934177951 2:89593837-89593859 AAGTTTCCACATATGAAATTTGG - Intergenic
934288249 2:91668138-91668160 AAGTTTCCACATATGAAATTTGG - Intergenic
934891347 2:98072775-98072797 CACTAACTGCAAATGAGATTGGG - Intergenic
936555874 2:113498617-113498639 CAGACTCTACCAATGAAAATGGG + Intergenic
937383018 2:121398760-121398782 CAGGATGTAAAAATGAGATTTGG - Intronic
938816896 2:134913976-134913998 CAATATCTACACATAAAATTAGG - Intergenic
938818718 2:134931581-134931603 CAGTTTCTACAAAAGAAGCTGGG + Intronic
939047185 2:137263662-137263684 ATCTATATACAAATGAAATTAGG - Intronic
941098651 2:161272557-161272579 CAATATTTATAAATGAAAGTTGG + Intergenic
941325419 2:164108862-164108884 CAGTAGCTTCAACTGAATTTCGG - Intergenic
942437423 2:175995581-175995603 CAGTTTCTACAAATAAAAGATGG - Exonic
942470595 2:176255818-176255840 CAGTAGCTGCAAAGGAAATGAGG - Intergenic
943840487 2:192574239-192574261 CATTTTCTACATAAGAAATTTGG - Intergenic
944799230 2:203220783-203220805 AAGTATATAAAAATGAAGTTTGG + Intronic
945031693 2:205670758-205670780 AAGTGTCTACAAAAGAACTTAGG - Intergenic
946523079 2:220487735-220487757 CAGTATTTAAAAATTAAATGTGG + Intergenic
947677337 2:231994402-231994424 CTGTATCTACAAAAGATCTTGGG + Intronic
1169310316 20:4532683-4532705 CAGTATAAAAACATGAAATTTGG + Intergenic
1170066795 20:12319505-12319527 CAGTATACACAAGAGAAATTGGG - Intergenic
1170537768 20:17358230-17358252 CCTGATATACAAATGAAATTTGG + Intronic
1171803578 20:29652085-29652107 TAGTTTCTAAAAATGAAATATGG - Intergenic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1174050872 20:47766471-47766493 CAGGATCTGGAAAGGAAATTAGG + Intronic
1174060608 20:47830248-47830270 CAATGCCTATAAATGAAATTTGG + Intergenic
1174071290 20:47901122-47901144 CAATGCCTATAAATGAAATTTGG - Intergenic
1174152763 20:48497539-48497561 CAATGCCTATAAATGAAATTTGG + Intergenic
1174884618 20:54319327-54319349 AAATATCTACAAATGATATATGG + Intergenic
1175672170 20:60913141-60913163 AAGTAACTACAAATGAAGTAAGG + Intergenic
1176318542 21:5279865-5279887 TAGTATCTGCAATGGAAATTTGG - Intergenic
1176476517 21:7219202-7219224 TAGTATCTGCAATGGAAATTTGG - Intergenic
1176696883 21:9988904-9988926 CAGTATCTGACAATGAAAATGGG - Intergenic
1176951274 21:15049660-15049682 CAGTTTCCACACATTAAATTAGG + Intronic
1177530243 21:22349536-22349558 AAGTTTCAACATATGAAATTTGG - Intergenic
1177667852 21:24185050-24185072 CAGTTTCAACACATGAATTTTGG - Intergenic
1177912806 21:27053315-27053337 CAGTATCTGCTTCTGAAATTGGG - Intergenic
1180396231 22:12344404-12344426 TAGTATCTGCAATGGAAATTTGG - Intergenic
1180403482 22:12519689-12519711 TAGTATCTGCAATGGAAATTTGG + Intergenic
1180556204 22:16578466-16578488 CAGAACCTAGAAATGAAGTTAGG + Intergenic
1182140192 22:27948169-27948191 CAGTGTTTACAAATACAATTTGG + Intergenic
950295391 3:11825179-11825201 CAGTATCCTCAAATGAAAAAGGG + Intronic
952170519 3:30801681-30801703 CAGTAAATGCAAATGGAATTTGG - Intronic
953358226 3:42272460-42272482 CAGTTTCAACATATGAATTTGGG + Intergenic
955457152 3:59135831-59135853 CAGTTTCTAGAAATTAAATGTGG + Intergenic
956148467 3:66216158-66216180 AAGTTTCTACACATGAATTTTGG + Intronic
957852523 3:85828045-85828067 CAGTAGCTGCAAGTGAAGTTGGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960235252 3:115274314-115274336 TAGTCTCTACAAGTGAAATATGG + Intergenic
961186592 3:124920339-124920361 CATTTTCTACAAATCAAATGAGG + Intronic
962224576 3:133594994-133595016 CAGTATCCAAAAATGCATTTAGG - Intergenic
963029540 3:140954400-140954422 CAGTACCTACAAGTGAGATAGGG + Intronic
963715412 3:148797135-148797157 CAGTTTCTTCAAATGTAATATGG + Intronic
963969093 3:151409337-151409359 CAGTACCTACAAAGCAAATGTGG - Intronic
964316996 3:155455606-155455628 CAGAATTTGCAAATGAATTTAGG + Intronic
964918399 3:161864803-161864825 TAGTATCTACAAAATAAAATGGG - Intergenic
966369958 3:179240461-179240483 CAGAACCTAGAAATGAAGTTAGG + Intronic
967322558 3:188209052-188209074 CAGTTTCTACACCTGAAAATTGG - Intronic
968257706 3:197292613-197292635 TAGTATCTACAAATAAAGATAGG + Intronic
969984135 4:11189568-11189590 CAGTTTCTGAAAATGAAACTGGG - Intergenic
970008465 4:11432359-11432381 CTTTATCCACAAAGGAAATTGGG + Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
971584685 4:28390148-28390170 AAATATATACAAATAAAATTAGG - Intronic
971864752 4:32154964-32154986 CAGTATCTAGAAACCAAAATAGG - Intergenic
973092319 4:46153181-46153203 CATTAATTACAAAGGAAATTTGG + Intergenic
973221420 4:47731455-47731477 CAGTGTCTACAGGTGAAATGAGG + Intronic
973348649 4:49083983-49084005 TAGAATCTACAAAAGATATTTGG + Intergenic
973537576 4:51898843-51898865 CAGCAGCTATAAAAGAAATTGGG + Intronic
973877621 4:55235674-55235696 TACTATCTAAAAAAGAAATTGGG - Intergenic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
975698718 4:77041222-77041244 CAGTATTTAAAAATCAAATTAGG + Intergenic
977020698 4:91755593-91755615 GAGTATCAACAGATGAATTTGGG - Intergenic
977882840 4:102225545-102225567 CAGTACCTACAAATGAAGCAGGG - Intergenic
978990618 4:115077641-115077663 CATTATATACATATAAAATTAGG + Intronic
979453002 4:120894551-120894573 CACTACTTATAAATGAAATTTGG + Intronic
979558192 4:122074958-122074980 CACTATTTACTAATGAAATATGG - Intergenic
980150466 4:129041440-129041462 CAATTTCTAAAAATAAAATTAGG - Intronic
981722862 4:147819101-147819123 CATTTTCAACTAATGAAATTAGG + Intronic
981908198 4:149947661-149947683 CAGTTTCTAGAAAAGAAATGTGG + Intergenic
982403394 4:154993691-154993713 CAATTTCAACATATGAAATTTGG + Intergenic
983759743 4:171390878-171390900 CAGAATCTACGAAGGAAATATGG - Intergenic
984014643 4:174411703-174411725 TAGAATCTATAAATCAAATTAGG - Intergenic
984107629 4:175569465-175569487 GAGTAATTACAAATAAAATTTGG + Intergenic
984179427 4:176463617-176463639 GAGTATCTACAAAAAATATTTGG - Intergenic
984439110 4:179744040-179744062 CAATATATAGAAATGAAAATTGG + Intergenic
985156251 4:186990282-186990304 CAGAACTTACAAATTAAATTGGG + Intergenic
986934194 5:12862938-12862960 AACTATCTAAAAATGAAACTTGG + Intergenic
987948051 5:24639657-24639679 TAGAATCTAAAAATGAAATCTGG - Intronic
987960081 5:24795545-24795567 CAGTATCTAGAAAAGAGTTTGGG + Intergenic
988095887 5:26609671-26609693 GAGTATCTAGGATTGAAATTAGG + Intergenic
988318577 5:29663026-29663048 CAGCATCTACAAATGATTTTCGG - Intergenic
988377267 5:30453205-30453227 AAGTATCTGCTAAAGAAATTAGG - Intergenic
989412383 5:41135373-41135395 CAGTATCTACTCTTGGAATTTGG - Intergenic
989539052 5:42597660-42597682 CAGTATCTACGATTGACAATCGG + Intronic
989842650 5:46099361-46099383 CACTATCTACAACTCAAATTCGG + Intergenic
989852044 5:46225507-46225529 TAGTATCTGCAAGGGAAATTTGG + Intergenic
991625305 5:68594898-68594920 GAGTTTGGACAAATGAAATTTGG + Intergenic
992117091 5:73549441-73549463 CAATATCTACAAATGAAATTTGG + Intergenic
992405699 5:76455565-76455587 CAGGATCTACACATGAAAGAGGG - Intronic
993809682 5:92460256-92460278 CAGTTTCTTCATCTGAAATTAGG - Intergenic
994017289 5:94982324-94982346 CAATAACAACAAATGAAATTTGG + Intronic
994044535 5:95293169-95293191 CAGTCTCTAGAAATGAAGTATGG - Intergenic
994729944 5:103480338-103480360 AGGTTTCAACAAATGAAATTGGG - Intergenic
994759533 5:103835629-103835651 AAGTTTCAACAAATGAATTTGGG - Intergenic
995145125 5:108779358-108779380 TTGAATCTATAAATGAAATTGGG + Intronic
995739440 5:115339650-115339672 CAGTTTGGACAAAGGAAATTGGG + Intergenic
996924047 5:128801508-128801530 CAATAATTACAACTGAAATTTGG - Intronic
1001728333 5:173927449-173927471 TTGTAGCTACAAATAAAATTTGG + Intronic
1001793204 5:174479084-174479106 AACTATCCAAAAATGAAATTAGG + Intergenic
1005197356 6:23303261-23303283 CTGAATCTACAAATAAACTTGGG + Intergenic
1005880188 6:30051558-30051580 TAGTATCTAATAATGAAGTTAGG + Intergenic
1007452097 6:41947887-41947909 CAGTCACTCCAAATGAAATGGGG - Intronic
1008834928 6:55814827-55814849 CAGTATATAAAATTGAAATATGG + Intronic
1009653273 6:66504889-66504911 CAATATATAGAAATGACATTAGG + Intergenic
1010386988 6:75291478-75291500 CAGTATCTACAGAGGCATTTGGG - Intergenic
1011022832 6:82833386-82833408 CATTATCTACAGAAGTAATTGGG + Intergenic
1011215868 6:85004971-85004993 CAGAATCTCCAACTTAAATTTGG + Intergenic
1011469571 6:87694483-87694505 CAGTATCTAGAACTCAAATGAGG + Intronic
1012006874 6:93723852-93723874 CATTATCTAAACATGAAAGTGGG - Intergenic
1012352059 6:98264119-98264141 CAGTCTATACAACAGAAATTGGG - Intergenic
1012365460 6:98433930-98433952 TAGCAGCTACAAATGAATTTTGG - Intergenic
1013250212 6:108326075-108326097 CAGTATCTCCAAAAAAAAATAGG - Intronic
1013735077 6:113216765-113216787 CAGGATCTTCAAAGGAAAATGGG + Intergenic
1014585165 6:123189278-123189300 CAGTGTCTCAAAATGAGATTCGG + Intergenic
1014874221 6:126636716-126636738 CAGTATTTGCAACTGGAATTTGG + Intergenic
1015290898 6:131537525-131537547 CAGTTTCAACATATGAATTTTGG - Intergenic
1015906323 6:138121013-138121035 CAGTGTCAACATATGAATTTTGG - Intergenic
1016533769 6:145088762-145088784 CAGAATGTATCAATGAAATTAGG + Intergenic
1017173054 6:151475894-151475916 CAGTTTCAACACATGAATTTTGG + Intergenic
1018520544 6:164645358-164645380 GATTATATACAAATGCAATTAGG - Intergenic
1018661465 6:166090939-166090961 CATTTTCAACACATGAAATTTGG + Intergenic
1021021947 7:15611313-15611335 GAATATCTTCAAATTAAATTCGG - Exonic
1021173754 7:17426114-17426136 AAGTTTCAACAAATGAATTTTGG - Intergenic
1021252687 7:18350856-18350878 CAGTAACTACAAAGCAAATGTGG - Intronic
1022861419 7:34370922-34370944 TAGTACTCACAAATGAAATTTGG - Intergenic
1023432747 7:40111675-40111697 CAGTATCTTCAAATCAAGCTAGG + Intergenic
1025018974 7:55465937-55465959 CAGTTTCAACATATGACATTTGG - Intronic
1025164002 7:56694472-56694494 CAGAATCTGGAAATGAAATGAGG + Intergenic
1025706288 7:63867610-63867632 CAGAATCTGGAAATGAAATGAGG - Intergenic
1027516247 7:79146012-79146034 CAGTTCCTACTAATAAAATTGGG - Intronic
1028618440 7:92797461-92797483 CTATATATACTAATGAAATTGGG + Intronic
1028635730 7:92987104-92987126 CAGTATCAACAAAAGAAAAAGGG + Intergenic
1029944277 7:104515340-104515362 AAGTGACAACAAATGAAATTTGG - Intronic
1031859567 7:126962598-126962620 CAGTATCTATAAATCAATTAAGG - Intronic
1032045321 7:128601886-128601908 CTGTCTCTACAAAAGAAATCAGG - Intergenic
1032301213 7:130689086-130689108 CAGTATCAACATATGAATTTAGG - Intergenic
1032560376 7:132884631-132884653 CATTTTCAACAAATAAAATTTGG + Intronic
1032577379 7:133069622-133069644 CAGGACCTACAGATAAAATTAGG + Intronic
1034235196 7:149561420-149561442 CAGTAGCTACAAGGGAAAGTGGG + Intergenic
1035098013 7:156372037-156372059 CATTAGGTACAAATGTAATTTGG + Intergenic
1037266535 8:17068187-17068209 CAGTAACTTCATATGAAATAAGG + Intronic
1037507905 8:19550881-19550903 CAGTAGATACAAATGAGAGTAGG - Intronic
1038549997 8:28459211-28459233 AAGTATATACAAAAGAAAATTGG + Intronic
1039145872 8:34446412-34446434 CACCATATACAAATGAAGTTTGG + Intergenic
1039205239 8:35145556-35145578 CCTTACCTAAAAATGAAATTGGG - Intergenic
1040119908 8:43672406-43672428 TAGAATCTGCAAAGGAAATTTGG + Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1041014398 8:53577578-53577600 CAATATTTCCAACTGAAATTTGG - Intergenic
1041977360 8:63815299-63815321 CAGTATATGCAAATGGAAGTGGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1043688295 8:83116294-83116316 CAGTATCTATAAATTACCTTAGG + Intergenic
1044500008 8:92943029-92943051 AACTATCTAAAAATGAAATAAGG + Intronic
1044742601 8:95343037-95343059 AAGTTTCTACATATGAATTTTGG + Intergenic
1045067996 8:98469282-98469304 CAGTTTCTAAAAATCTAATTTGG - Intronic
1045230656 8:100303468-100303490 CAGAATCTGCAAATGTTATTTGG - Intronic
1045254011 8:100504050-100504072 GAGTATCTACATATGCTATTTGG - Intergenic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1045605742 8:103772588-103772610 CTGTATATATAAATCAAATTGGG - Intronic
1047323923 8:123818315-123818337 CAGTTTCAACATATGAATTTTGG + Intergenic
1047601887 8:126433752-126433774 CATTATCTATAAAAGCAATTGGG - Intergenic
1048591292 8:135823246-135823268 CATTATCTACATTTGAAAATAGG - Intergenic
1049897149 9:118736-118758 CAGACTCTACCAATGAAAATGGG - Intergenic
1050765675 9:9130532-9130554 CAATATCTAGGAATGAAAGTAGG + Intronic
1051156178 9:14148733-14148755 GAGTATCTACAAATGTACTCAGG - Intronic
1052869094 9:33486048-33486070 CTGTCTCTACAAAAAAAATTAGG + Intergenic
1053740251 9:41129001-41129023 CAGACTCTACCAATGAAAATGGG - Intergenic
1054443214 9:65284994-65285016 CAGACTCTACCAATGAAAATGGG - Exonic
1054487066 9:65736507-65736529 CAGACTCTACCAATGAAAATGGG + Intergenic
1054688097 9:68302312-68302334 CAGACTCTACCAATGAAAATGGG + Intergenic
1054869179 9:70033455-70033477 CAGAAACTAGAAATGAAAATTGG - Intergenic
1055493845 9:76834345-76834367 AAGAATCTACAAATGAACTCAGG + Intronic
1055722228 9:79188199-79188221 CAGTACTTACAGATGAATTTAGG - Intergenic
1057288692 9:93784214-93784236 CAATAGCCACAAATGAAATAAGG - Intergenic
1057349674 9:94285144-94285166 CAGTGTATACAAATGATACTTGG + Intronic
1057775230 9:98002489-98002511 CAGTATTTACACATTACATTGGG + Intronic
1057816079 9:98296068-98296090 CAGTTTCAACACATGAATTTGGG - Intronic
1058087790 9:100768077-100768099 TAATATCTAGAAATGCAATTTGG + Intergenic
1058089931 9:100794174-100794196 TAGTATATACAAATGCAGTTGGG + Intergenic
1058109842 9:101020197-101020219 AAGGATCTACAAATGGATTTTGG - Intergenic
1058123351 9:101163739-101163761 CACTATCTATAAATAAACTTTGG - Intronic
1059022145 9:110587995-110588017 GATAATTTACAAATGAAATTTGG - Intergenic
1059174983 9:112161509-112161531 TTCTATCTACAAATTAAATTGGG - Intronic
1059834181 9:118131422-118131444 CAGTAGCTACAAAAGAGATGTGG - Intergenic
1059919583 9:119143294-119143316 AAGCATATACAAATTAAATTAGG + Intergenic
1060319389 9:122541824-122541846 CAGTTTCCACAAATGTTATTTGG + Intergenic
1060862219 9:126963922-126963944 CAGGATCTACATATGAGACTGGG + Intronic
1203406087 Un_KI270538v1:4674-4696 CAGTATCTGCAAGTGAATTTTGG + Intergenic
1203411952 Un_KI270579v1:21888-21910 TAGTATCTGCAATGGAAATTTGG - Intergenic
1203412106 Un_KI270579v1:25300-25322 TAGAATCTACAAATGACATTTGG - Intergenic
1186452514 X:9685293-9685315 CAGTCTCTAAAAATAAAATAGGG - Intronic
1186568245 X:10687102-10687124 CCGGAGCTGCAAATGAAATTTGG - Intronic
1186586824 X:10884103-10884125 CATTTTCAGCAAATGAAATTTGG + Intergenic
1186620247 X:11232928-11232950 CAGTTTCCAAAAATAAAATTAGG - Intronic
1186630189 X:11340289-11340311 CAGTATGTACAAAAGAGAGTTGG - Intronic
1187896516 X:23985990-23986012 CAGTTTCCAAACATGAAATTTGG - Exonic
1188059843 X:25587856-25587878 AATGCTCTACAAATGAAATTTGG + Intergenic
1188127057 X:26382400-26382422 CAGTATTTACAGTTTAAATTTGG + Intergenic
1188270257 X:28130538-28130560 ATGTATCTATAAATAAAATTAGG - Intergenic
1189287708 X:39863637-39863659 CAGTTTCAACATATGAATTTTGG + Intergenic
1189720444 X:43910648-43910670 CACTATCTACAAAGGAAGTGAGG + Intergenic
1191273257 X:58507569-58507591 TAGTACCTGCAAATGATATTTGG + Intergenic
1191574419 X:62681276-62681298 TAGAATCTACAAAAGATATTTGG + Intergenic
1191581660 X:62769054-62769076 TAGTATCCGCAAATGACATTTGG - Intergenic
1193102521 X:77631331-77631353 TAATATCTACACATAAAATTTGG - Intronic
1193305002 X:79938610-79938632 CAGAATCTAAAAATGAAAACAGG - Intergenic
1194181926 X:90721159-90721181 CAGTATCTACCACGCAAATTAGG + Intergenic
1196021793 X:110998585-110998607 CAGTATCTAGAAGAGGAATTAGG + Intronic
1197164677 X:123363764-123363786 CAGAACCTACAAATCAAAATGGG + Intronic
1197167817 X:123397694-123397716 CAGTATGTCCAAATACAATTGGG - Intronic
1197993547 X:132346300-132346322 TGGTAGATACAAATGAAATTAGG - Intergenic
1199371827 X:147058293-147058315 CATTTTCAACACATGAAATTTGG - Intergenic
1200528553 Y:4303076-4303098 CAGTATCTACCACGCAAATTAGG + Intergenic
1200862526 Y:8008211-8008233 CACAATCTTCAAATGAGATTGGG - Intergenic
1200862879 Y:8011638-8011660 CACAATCTTCAATTGAAATTGGG - Intergenic