ID: 1045440960

View in Genome Browser
Species Human (GRCh38)
Location 8:102210338-102210360
Sequence TCTAGTGAGTCTATGGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045440960_1045440963 30 Left 1045440960 8:102210338-102210360 CCAATAGCCATAGACTCACTAGA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1045440963 8:102210391-102210413 GATCTAAGTCATTCATGGCATGG No data
1045440960_1045440962 25 Left 1045440960 8:102210338-102210360 CCAATAGCCATAGACTCACTAGA 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1045440962 8:102210386-102210408 AATTAGATCTAAGTCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045440960 Original CRISPR TCTAGTGAGTCTATGGCTAT TGG (reversed) Intronic
906364690 1:45196923-45196945 TCTAGTCAGTAAATGGCTCTTGG - Intronic
911345711 1:96694298-96694320 GCTCGTGAGTCTATGGGTCTGGG + Intergenic
912069263 1:105787566-105787588 TCTAGGGATTTTATGGCTTTAGG - Intergenic
915610395 1:156987189-156987211 TCTACTTAGTCTTTTGCTATAGG - Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918258868 1:182775946-182775968 TGTAGTTGGTCTATGGCTGTGGG - Intergenic
1067143542 10:43676606-43676628 TCTGGTGAGTCTGTGGCTTCTGG + Intergenic
1068247626 10:54392950-54392972 TCTAGTCAGAGTATGGCTAAGGG + Intronic
1068788702 10:61004028-61004050 TCTAGGGATTTTATGGCTTTAGG + Intergenic
1072807797 10:98435616-98435638 CCTGGTGAGTCTATAGCTCTGGG - Exonic
1074646165 10:115455514-115455536 TCTAGGGATTTTATGGTTATAGG - Intronic
1075723975 10:124602495-124602517 TCCAGTGAGTCTGTGGCTCCTGG + Intronic
1077731971 11:4741026-4741048 TCTAGGGATTTTATGGCTTTGGG + Intronic
1079877513 11:25878191-25878213 TCTAGGGTGTTTATGGCTTTAGG + Intergenic
1080542621 11:33282717-33282739 TTTTCTGAGTCTATGGGTATGGG + Intronic
1085949278 11:81309948-81309970 TCTACTGGTTCTATGGCTCTAGG + Intergenic
1091610484 12:2003908-2003930 TACAGTGAATCTGTGGCTATGGG - Intronic
1092292874 12:7174350-7174372 TCTAGTGGGTCATTTGCTATGGG + Intergenic
1092604898 12:10107885-10107907 TCTAGGGTTTCTATGGCTTTAGG - Intronic
1093272518 12:17081977-17081999 TGTAGTGAGAGTTTGGCTATGGG + Intergenic
1095325456 12:40886679-40886701 TCTAGGGTTTCTATGGCTTTAGG + Intronic
1095779259 12:46040955-46040977 TCTAGAGTTTCTATGGTTATAGG - Intergenic
1113184129 13:107667261-107667283 TTTAGTGTGTTTATGGGTATTGG - Intronic
1113528148 13:110998569-110998591 TCTAGTGTTTTTATGGCTTTGGG - Intergenic
1114358723 14:21945574-21945596 TTTAATGAGTCTGTGTCTATCGG - Intergenic
1114363887 14:22006111-22006133 TCTAGGGAGTTTATGGTTTTAGG + Intergenic
1116182155 14:41548779-41548801 TCTACAGAGTCTATTGCAATCGG - Intergenic
1120339452 14:83200763-83200785 TCTAGTGATTCTGTGGTTGTTGG - Intergenic
1120410168 14:84144385-84144407 TCCAGGCACTCTATGGCTATAGG + Intergenic
1120507267 14:85368050-85368072 TCTAGAGATTTTATGGCTTTAGG + Intergenic
1121558299 14:94855330-94855352 TCAAGTCTGTCTATGGCTTTGGG - Intergenic
1125412339 15:39418393-39418415 TCTAGAGAATCTAAGTCTATAGG + Intergenic
1125714381 15:41811006-41811028 TCTAGAGTCTCTATGGCTCTGGG + Intronic
1138790504 16:59898316-59898338 TCTACTGATTCTATTTCTATTGG - Intergenic
1138798685 16:60000191-60000213 TCAACTGGGGCTATGGCTATGGG + Intergenic
1140845335 16:78881788-78881810 TATAGTGATTTTATGGATATAGG + Intronic
1152296934 17:79473043-79473065 TCTAGTGATTCTATTTTTATAGG - Intronic
1154425298 18:14267488-14267510 GCTAGTGAGTCTATGAATCTGGG - Intergenic
1154432994 18:14322727-14322749 GCTAGTGAGTCTATGAATCTGGG - Intergenic
1159778030 18:72626391-72626413 TCAGGTGAGTGTATGGCTAAGGG - Intronic
1160578442 18:79870090-79870112 TCCAGTGAGTCTGTGGCCTTCGG + Intronic
1165652418 19:37502863-37502885 TCCAGTGAGCTTATGCCTATAGG - Intergenic
926390977 2:12392623-12392645 TCTAGTGAGTATATCAATATAGG - Intergenic
930063555 2:47310609-47310631 TGTGGTGAGTCTCTGGCTCTGGG + Intergenic
930239852 2:48924909-48924931 TCTAGGGTTTCTATGGCTTTAGG - Intergenic
931094475 2:58923625-58923647 GCAAGTGAGCCCATGGCTATAGG + Intergenic
937210096 2:120262980-120263002 TCTAGTGAGTCAGTGGCTGAAGG + Intronic
937497763 2:122442120-122442142 TCTAGTGACTCTTTGGCCATTGG - Intergenic
942040129 2:172052624-172052646 TCTAGTGTGTTTTTAGCTATGGG - Intronic
944135331 2:196393176-196393198 TCTAGGGATTTTATGGCTTTAGG - Intronic
944409172 2:199420377-199420399 TCTAGTGAGACTATGTCTTAAGG + Intronic
945490622 2:210450373-210450395 TCTAGTGATTTTATGGTTTTAGG - Intronic
945668630 2:212774185-212774207 TTTAGTCAGTCTCTGGCAATTGG - Intergenic
945701193 2:213172825-213172847 TCTACTGAATCTGTGGCTCTAGG - Intergenic
947174858 2:227355270-227355292 GCTAGTGAGTCTGTGCCTATGGG + Intronic
1170751208 20:19147326-19147348 TTTAGTGAGCCTATGGCCCTGGG - Intergenic
1170910858 20:20566315-20566337 TCTTTTGTGTCCATGGCTATCGG - Intronic
1171125166 20:22596400-22596422 TTTAGTCAGTCTATTACTATTGG + Intergenic
1174895859 20:54449395-54449417 GTTAGTGTGTCTTTGGCTATAGG - Intergenic
950917968 3:16664875-16664897 TCTAGAGAGGCTGTGGCTCTGGG - Intronic
958795898 3:98705895-98705917 TCTAGTGGGTCAATTGCTACAGG + Intergenic
962391964 3:134979850-134979872 TCTAGTCAGTATATGGTTGTAGG + Intronic
965211319 3:165793139-165793161 TCTAGTAATTTTATGGCTTTAGG + Intronic
965684962 3:171292887-171292909 TCTAGGGAGCCTGTGGCCATTGG - Intronic
974124420 4:57678008-57678030 TCTAGTCACTCTATGGTTAATGG + Intergenic
975479762 4:74864831-74864853 TCTAGGGTTTCTATGGCTTTAGG - Intergenic
977747902 4:100573357-100573379 TGTAGTGAGTCTATAACAATTGG + Intronic
979507548 4:121515040-121515062 TCTAGTGAAGCTGTGGCAATGGG + Intergenic
985313860 4:188632906-188632928 TTTAGTGAGTCTATGCCTCTGGG - Intergenic
990092389 5:52069156-52069178 TCTAGTGATTTTATAGCTTTGGG - Intronic
990196549 5:53323428-53323450 TCTATTGAGGCTATGGCTAATGG - Intergenic
996271237 5:121607177-121607199 TCTAGTGTTTTTATGGCTTTAGG - Intergenic
997062227 5:130520385-130520407 TCTAGGGAGTATATAGCTCTGGG - Intergenic
998811157 5:145967307-145967329 CCTAGTCAGTCTCTGACTATTGG + Intronic
1005420193 6:25640800-25640822 TCTAGTGGGTCTCTAGCCATTGG - Intergenic
1005586481 6:27281069-27281091 TCTAGTGGGTATATAGCTAAAGG + Intergenic
1005844934 6:29769828-29769850 TCTCCTGAGTAAATGGCTATAGG - Intergenic
1005862878 6:29914778-29914800 TCTCCTGAGTAAATGGCTATAGG - Intergenic
1010529999 6:76956789-76956811 TCTAATGAGTCTGTGACTTTAGG + Intergenic
1011905332 6:92359520-92359542 TATAGAGAGTCTAAGGATATAGG + Intergenic
1015048182 6:128804255-128804277 TCTAATGAGGCAAAGGCTATTGG + Intergenic
1015415248 6:132940536-132940558 TCTAGTGGATCTATGGGAATGGG + Intergenic
1018143812 6:160864471-160864493 GGTAGAGAGTCTATGGCTCTGGG - Intergenic
1021445389 7:20728087-20728109 ACTAGAGAGTATATGACTATAGG + Intronic
1025855301 7:65271184-65271206 TTTAGAGAGTCTCTGGCTTTGGG + Intergenic
1027813453 7:82936741-82936763 ACTAATGAATATATGGCTATTGG - Intronic
1027843804 7:83346639-83346661 TCTAGAGAGTTTATGGTTTTAGG - Intergenic
1028201991 7:87972972-87972994 TCTAGGGAGTTTATGGTTTTAGG - Intronic
1030452041 7:109724135-109724157 TCTAGTGTTTCTATGGTTTTAGG - Intergenic
1030702552 7:112657364-112657386 TCTAGTGTTTTTATGGCTTTAGG + Intergenic
1034131318 7:148720706-148720728 ACTTGTGAGTCTGTGGCTTTTGG + Intronic
1034747291 7:153534396-153534418 TCTACTGATTCTATGGCCTTTGG - Intergenic
1043725581 8:83606447-83606469 TCTAGGGATTTTATGGCTTTAGG - Intergenic
1044094623 8:88047903-88047925 ACTAGGGAGTCAATAGCTATAGG + Intronic
1045440960 8:102210338-102210360 TCTAGTGAGTCTATGGCTATTGG - Intronic
1058695579 9:107556351-107556373 TGTAGTGAGTCCATGTCCATGGG - Intergenic
1188514122 X:30966727-30966749 TCTAGTGAGTAGTTGGCTATAGG + Intronic
1188628463 X:32318507-32318529 TCTAATGAGTCTAAGCATATTGG + Intronic
1191781504 X:64872808-64872830 TCTTCTGAGTCTAAGGTTATGGG + Intergenic
1193100121 X:77601343-77601365 TCTAGGGTATCTAGGGCTATAGG - Intronic
1193936031 X:87623108-87623130 TCTATTGAATTTGTGGCTATAGG + Intronic
1195066266 X:101240859-101240881 TCTAGTTAGCCTGGGGCTATGGG + Intronic
1201409542 Y:13685457-13685479 TCTAGGGATTTTATGGCTTTAGG - Intergenic