ID: 1045443171

View in Genome Browser
Species Human (GRCh38)
Location 8:102235516-102235538
Sequence ATGACCTAGTTGACTTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045443171_1045443172 -1 Left 1045443171 8:102235516-102235538 CCTCACAAAGTCAACTAGGTCAT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1045443172 8:102235538-102235560 TTAGAAGAGATAATGAATTCAGG No data
1045443171_1045443174 9 Left 1045443171 8:102235516-102235538 CCTCACAAAGTCAACTAGGTCAT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1045443174 8:102235548-102235570 TAATGAATTCAGGCCCGGCGTGG No data
1045443171_1045443173 4 Left 1045443171 8:102235516-102235538 CCTCACAAAGTCAACTAGGTCAT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1045443173 8:102235543-102235565 AGAGATAATGAATTCAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045443171 Original CRISPR ATGACCTAGTTGACTTTGTG AGG (reversed) Intronic
901396397 1:8985273-8985295 ATGGCCTGGTGGCCTTTGTGAGG - Intergenic
901407120 1:9056799-9056821 ATGTCCTAGATGACACTGTGGGG + Intronic
902285815 1:15407968-15407990 GTTACCTATTTGGCTTTGTGTGG - Intergenic
907158574 1:52355632-52355654 ATGACCTGGATGCTTTTGTGCGG - Exonic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910295132 1:85636830-85636852 ATGACGTAGTTGACATTGCTTGG + Intergenic
912403111 1:109412781-109412803 GTTTCCTAATTGACTTTGTGTGG - Intronic
912994558 1:114520067-114520089 ATGACCTACTTGACCTTCTTGGG - Intergenic
915194315 1:154178028-154178050 ATGGCCTTGTTGGGTTTGTGAGG - Intronic
924812686 1:247416980-247417002 ATGAACAAGTTGGCTTTGTTTGG - Intronic
1063163684 10:3440318-3440340 ATGAGTTAGATGACTTTGGGTGG + Intergenic
1063739479 10:8801912-8801934 AAGAACTAGTTGCCTTTCTGAGG + Intergenic
1068461528 10:57336191-57336213 ATGACAAAGTTAAATTTGTGAGG - Intergenic
1074379816 10:112970206-112970228 CTCTCCTAGTTGTCTTTGTGTGG - Intronic
1080133502 11:28825151-28825173 ATGACCTAGCTGAATTTGTTAGG - Intergenic
1081366279 11:42239233-42239255 ATTACCTAGTTGTCTCTTTGGGG - Intergenic
1083385512 11:62306436-62306458 GTGGCTTAGTTTACTTTGTGAGG + Intergenic
1083719521 11:64597531-64597553 GTGACCCAGTGGACTTGGTGGGG - Intronic
1087596904 11:100265447-100265469 ATGACCTAGTGGAGCTGGTGTGG - Intronic
1090509249 11:127355301-127355323 ATGACTTAATTGGCTTTTTGTGG - Intergenic
1092130078 12:6104990-6105012 ATGTCATATTTGACTTTATGTGG - Intronic
1095162659 12:38935811-38935833 AGGACCTATTTGACTTTGAGTGG - Intergenic
1095838199 12:46662046-46662068 CTGACCTTTCTGACTTTGTGAGG + Intergenic
1097907837 12:64938600-64938622 AAGACCTAGGTGACTTTGATTGG + Intergenic
1098158638 12:67625865-67625887 ATGACCTAGTTGTCTTTATTTGG + Intergenic
1100110134 12:91231755-91231777 ATTTCCTAGATGACTTTTTGCGG - Intergenic
1101825557 12:108217646-108217668 CTGGCCTATTTTACTTTGTGGGG - Intronic
1116449118 14:45045108-45045130 ATTGCCTAGATGATTTTGTGTGG - Intronic
1118637026 14:67757309-67757331 AGGACCTTGTGGACATTGTGAGG - Intronic
1120169522 14:81234968-81234990 ATGAGCTAGTAGATTTAGTGGGG + Intergenic
1121703279 14:95972988-95973010 ATGTCTTAGTTTACTTTGTTGGG + Intergenic
1128029268 15:64465238-64465260 ATGATGTAATTGACTTTTTGTGG + Intronic
1131368294 15:91857981-91858003 ATGACATAGATGACTGAGTGTGG + Intronic
1132710180 16:1262948-1262970 ATGACCTGGTGGGCATTGTGGGG - Intergenic
1132712666 16:1276465-1276487 ATGACCTGGTGGGCATTGTGGGG - Intergenic
1134113397 16:11530418-11530440 ATGACCTAGTTCACCTTGCAGGG - Intergenic
1142258326 16:89027515-89027537 ATGACTTAGTTGACATTGATAGG - Intergenic
1144493312 17:15732513-15732535 CTGACCTGGTGGACTCTGTGGGG + Intronic
1144906949 17:18644139-18644161 CTGACCTGGTGGACTCTGTGGGG - Intronic
1149025670 17:52024971-52024993 ATGTCATAGCTGACTTTTTGGGG - Intronic
1153278453 18:3391919-3391941 AGGATTTAGTTGACATTGTGAGG - Intergenic
1154258902 18:12811525-12811547 ATGACATTGTTGGGTTTGTGGGG - Intronic
1155735241 18:29213866-29213888 ATTACCTAGTTTCTTTTGTGAGG + Intergenic
1158167165 18:54553810-54553832 CTGACCTCTTTGGCTTTGTGGGG - Intergenic
1159058541 18:63490993-63491015 ATGACATAATGGACTTTGTGGGG - Intronic
925281989 2:2691135-2691157 ATGCCTTAGTTACCTTTGTGAGG - Intergenic
929435122 2:41922945-41922967 CTGACCTATTTCACTTTGGGTGG - Intergenic
931647646 2:64439427-64439449 TTGACCTTGCTGTCTTTGTGTGG + Intergenic
936412927 2:112276114-112276136 ATGACCTAGACGTCTCTGTGTGG + Intronic
937187844 2:120062349-120062371 ATGACCTTGTTGAATTTTTCAGG + Intronic
944624522 2:201557780-201557802 GTGACCTAGTTGGCTTGATGTGG - Intronic
945147193 2:206750755-206750777 ATTACCTAGTTGATATTCTGTGG + Intronic
945602617 2:211887470-211887492 AGGATCTAGTTGAATTTTTGAGG - Intronic
1170927942 20:20742818-20742840 AAGACCTGGTTGACTTGGTTGGG + Intergenic
1174109856 20:48191450-48191472 ATGGCCTAGTGGACTTTGCTAGG - Intergenic
1174705846 20:52655297-52655319 TTAACTTAGTTGAATTTGTGAGG + Intergenic
1178226093 21:30720542-30720564 ATGACCTGTTTGACTTAATGTGG - Intergenic
1178716058 21:34965620-34965642 ATGTCCTTGTTTACTTTCTGTGG + Intronic
1178811420 21:35885863-35885885 ATGAGTTAGTTGACTTTTTTGGG - Intronic
1179086585 21:38223786-38223808 ATGTACTAGTTGTCTTTTTGGGG - Intronic
1179334141 21:40434206-40434228 CTGTCCTGGTGGACTTTGTGTGG - Intronic
1179560890 21:42215470-42215492 ATCACCCAGTTGACTTCGAGTGG - Intronic
1182003718 22:26941824-26941846 ATGACATACTTATCTTTGTGGGG - Intergenic
950228101 3:11252555-11252577 AGGACCTACTTGCCTTTGAGTGG - Intronic
953113166 3:39963515-39963537 ATGAAATAGGTGACTTTGTTTGG + Intronic
961076691 3:123989413-123989435 AGGACCTAGTTCAATTTTTGTGG - Intronic
965694369 3:171392105-171392127 ATGAATTAGCTGATTTTGTGAGG - Intronic
972293681 4:37716008-37716030 ATTACCTAGTTGTTCTTGTGAGG + Intergenic
974338668 4:60585811-60585833 ATGAGTTAGTTATCTTTGTGGGG + Intergenic
975713027 4:77179253-77179275 GTGACCTAGGTGACTTTCTGAGG + Intronic
979920129 4:126486498-126486520 ATGACCTACTTTACTGTGTCTGG - Intergenic
982091586 4:151884374-151884396 ATGCCCTATTATACTTTGTGTGG - Intergenic
984446074 4:179837416-179837438 ATGAGCCAGTTGACATGGTGAGG + Intergenic
985020916 4:185689449-185689471 ATCATCAAGTTGCCTTTGTGTGG + Intronic
991964469 5:72077555-72077577 ATAACCTAGTTGACAGTGTGTGG + Intergenic
992553053 5:77877344-77877366 AAAACCAAGTTGACTTTGTTTGG - Intergenic
994438051 5:99763577-99763599 ATGACTTTGTTTACATTGTGAGG + Intergenic
997693611 5:135844385-135844407 ATGACTTAGGTGAGTTTGGGAGG - Intronic
1002577982 5:180187926-180187948 ATGCCATAGTTGACTTTTTGAGG - Intronic
1007659244 6:43472674-43472696 CTGACTTATTTCACTTTGTGTGG + Intergenic
1011037324 6:82991887-82991909 ATGACCTTATTGATTATGTGTGG - Intronic
1013492023 6:110657145-110657167 TTGACCAAGTTCACTCTGTGCGG + Intronic
1015137010 6:129883666-129883688 ATGACCCAGTTGAGTTGATGTGG + Intergenic
1015139395 6:129912523-129912545 ATGAGCAAGTGGAGTTTGTGTGG + Intergenic
1018494161 6:164331297-164331319 ATGAACTTTTTGACTTTATGTGG + Intergenic
1020405008 7:7823230-7823252 ATGACCTATTTATCTTTTTGGGG - Intronic
1020942622 7:14560452-14560474 ATGAAGTAGTTGTCTTTCTGTGG + Intronic
1022100721 7:27167414-27167436 ATGACCTAGAGGAATTTATGGGG - Intronic
1027945510 7:84739996-84740018 ATGATCTAGCTCAGTTTGTGTGG - Intergenic
1029159478 7:98541385-98541407 ATGACCTTGAAGGCTTTGTGAGG - Intergenic
1029813600 7:103072924-103072946 ATAACCAAGTTGACTTCGTCTGG - Intronic
1030239799 7:107309680-107309702 ATGAAAGAGTTGGCTTTGTGTGG + Intronic
1031190724 7:118546357-118546379 ATGACCTAATTGATTTGGGGTGG - Intergenic
1031301437 7:120066643-120066665 TTGCTCTGGTTGACTTTGTGAGG - Intergenic
1031807158 7:126321149-126321171 ATGACTCAGTTAACTTTGTCAGG - Intergenic
1034833838 7:154333209-154333231 ATGACATGTTTGACTATGTGAGG + Intronic
1040062944 8:43120082-43120104 ATGCCTTAGTTGTCTTTATGTGG - Intronic
1044990591 8:97791990-97792012 AAGACCTGGTTGAATTTGGGGGG + Intronic
1045443171 8:102235516-102235538 ATGACCTAGTTGACTTTGTGAGG - Intronic
1046103216 8:109638284-109638306 ATGACCTAGGTGAGTGTGTCAGG - Intronic
1050990656 9:12147511-12147533 ATGACCTTTTTGAGTATGTGTGG + Intergenic
1055195111 9:73581507-73581529 ATGACCTAGAAGACATTCTGTGG - Intergenic
1055406904 9:75984503-75984525 ATGAACTAGTTAACTTTATTAGG + Intronic
1056623937 9:88238229-88238251 ATGACCTGGTTGCTTCTGTGTGG + Intergenic
1057638776 9:96796847-96796869 ATGAGCTCTTTGACTTTGAGTGG - Intergenic
1061752200 9:132786864-132786886 ATGACATATTTGATTTTGTTAGG - Intronic
1187631674 X:21180003-21180025 ATGACTTAGTTGAATATGTTGGG - Intergenic
1190147717 X:47911549-47911571 ATTAACTAATTGAATTTGTGGGG + Intronic
1190567673 X:51747328-51747350 ATGAGCTAGTTGAATAGGTGTGG + Intergenic
1201533709 Y:15022193-15022215 ATGTCTGAGTTGACTTTGTGGGG + Intergenic