ID: 1045446225

View in Genome Browser
Species Human (GRCh38)
Location 8:102267417-102267439
Sequence CAATATTGACAGCTTTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045446225 Original CRISPR CAATATTGACAGCTTTCACC TGG (reversed) Intronic
903570097 1:24297893-24297915 CAAGCCTGACAGCTTTCACCAGG - Intergenic
909420813 1:75463008-75463030 GAATATTGATATCTTTCTCCAGG - Intronic
911181484 1:94864350-94864372 AAATATTGCCAGCATTCACCTGG - Intronic
911302840 1:96196672-96196694 TAATATTAACATCCTTCACCTGG - Intergenic
911666000 1:100552796-100552818 CAAAATTGACAACTTTAGCCAGG - Intergenic
911967976 1:104391379-104391401 GAATATTGATATCTTTCCCCAGG - Intergenic
911997952 1:104791156-104791178 CTCAAATGACAGCTTTCACCTGG - Intergenic
913165740 1:116182793-116182815 CTATTTTGCCAGCTTTCTCCTGG + Intergenic
913596794 1:120386346-120386368 CAATGTTGACAGCCTTCTCTAGG - Intergenic
914090474 1:144492635-144492657 CAATGTTGACAGCCTTCTCTAGG + Intergenic
914308132 1:146441587-146441609 CAATGTTGACAGCCTTCTCTAGG - Intergenic
914593974 1:149131546-149131568 CAATGTTGACAGCCTTCTCTAGG + Intergenic
917511715 1:175674439-175674461 CAAGATTGACAGCTTAAGCCTGG - Intronic
918539518 1:185614523-185614545 GAATATTGATATCTTTCTCCAGG + Intergenic
1064539689 10:16392747-16392769 CAATATTGACTGCTTTCCAGGGG + Intergenic
1068044099 10:51863317-51863339 CTATCTTGACAGTGTTCACCTGG + Intronic
1070536358 10:77380951-77380973 CAATATTTACAGCTTAGCCCTGG + Intronic
1072282687 10:93882817-93882839 GAATATTGACATCTTTCTCTAGG - Intergenic
1074440443 10:113472925-113472947 CCATTTTGATAGCTTTCAACAGG + Intergenic
1075195116 10:120349712-120349734 CAATATTGGCATCTTTCTCTAGG - Intergenic
1078723928 11:13910912-13910934 TAATATTAAGAGCTTTCAGCTGG - Intergenic
1081120183 11:39256488-39256510 CAACCTTGACAGCTTTCATGTGG - Intergenic
1083949215 11:65944828-65944850 CAACATTGAAAGCTTACCCCAGG - Intergenic
1085061438 11:73450693-73450715 CAATAGTGACAGGTTTCAACTGG + Intronic
1088655502 11:111995480-111995502 CACTATTGACAGCTTGGAGCAGG + Intronic
1088866969 11:113857560-113857582 CAATAGTAACAGCTATGACCAGG + Intronic
1090065079 11:123496486-123496508 CAATATTGATATCTTTCTCTAGG + Intergenic
1090666563 11:128918538-128918560 CAGTATTCACAGCTCTCAACTGG + Exonic
1091531612 12:1362287-1362309 CAAAGTTGCCAGCATTCACCAGG + Intronic
1092944819 12:13442926-13442948 CAATATTAACAGCATTTACTAGG - Intergenic
1095125623 12:38473152-38473174 CAAAATTGATAGCCTTCACTTGG + Intergenic
1096922719 12:55105432-55105454 CAAAATTGTCAGCTTACACAAGG + Intergenic
1101490033 12:105201655-105201677 CAAAATTAACTGCTTTCAACTGG + Intronic
1101853698 12:108424705-108424727 CAAAATTGTCAGCTTTCCCAAGG - Intergenic
1108917049 13:55627467-55627489 CAATTTTTACAGCTTTCATTGGG - Intergenic
1108951256 13:56097557-56097579 CAATGTTGATAGCTTTGGCCTGG - Intergenic
1110359654 13:74610729-74610751 CAGTATTGGCAGCTTCCACGTGG + Intergenic
1110483243 13:76007677-76007699 CAATAATCATAGCTTTCACTAGG - Intergenic
1110915022 13:81010689-81010711 CAATATTGATATCTTTCTCCAGG + Intergenic
1114936474 14:27544754-27544776 CACTATTGACAACTCTCACCAGG - Intergenic
1115401951 14:32971585-32971607 TAATACTGATAGCTTTCAGCAGG + Intronic
1117894367 14:60465444-60465466 CCATATTCACTGCTTCCACCTGG + Intronic
1118041470 14:61921579-61921601 CCATATTGACTGGTGTCACCTGG + Intergenic
1120082573 14:80232427-80232449 CAATATTGTCAGATGTCCCCTGG + Intronic
1120100291 14:80436727-80436749 CAATATTGATATCTTTCTCTAGG - Intergenic
1124371795 15:29108299-29108321 CAACATTGTCAGCTGTCCCCCGG + Exonic
1129135992 15:73551977-73551999 AAATATTGACACATTTCATCAGG - Intronic
1130400177 15:83545048-83545070 GAATATTGACATCTTTCTCCAGG + Intronic
1133833709 16:9348863-9348885 GAATATTGATAGCTTTCTCTAGG + Intergenic
1135673163 16:24392003-24392025 CACTTTTGGCAGCTCTCACCAGG - Intergenic
1138822031 16:60272318-60272340 CTATATTCACAGCTTTTACTGGG + Intergenic
1152919723 17:83060010-83060032 GGATATGGACAGCTGTCACCAGG - Intergenic
1155688655 18:28587973-28587995 CAAGATTGCCAGCTTTCAGATGG + Intergenic
1158853177 18:61516013-61516035 CAACATGGACAGCTTTGACTAGG + Intronic
1159172621 18:64791235-64791257 ACATATTCACAGATTTCACCAGG - Intergenic
1160468382 18:79103174-79103196 CAATACTGTCAGCTCCCACCTGG - Intronic
1160577094 18:79863052-79863074 GACTCTTGACAGTTTTCACCAGG + Intergenic
1162152973 19:8658471-8658493 AAACATTGACAACTTTCCCCTGG + Intergenic
1168449203 19:56450087-56450109 GAATTTTGACATCTTTCTCCAGG - Intronic
925605488 2:5655716-5655738 CAATGTTGACAGCCTTCTCTAGG - Intergenic
927882653 2:26699514-26699536 CACTATAAACAGCTTTCAGCTGG + Intronic
930778494 2:55198633-55198655 GAATATTGATAGCTTTCTCTAGG - Intronic
930920088 2:56742572-56742594 CATTATTAACAGATGTCACCTGG - Intergenic
932277841 2:70464740-70464762 GAATAAAGACAGCTTTCAACAGG + Intronic
936738750 2:115478102-115478124 CAATCTAGTCAGCTTCCACCAGG + Intronic
936822734 2:116542688-116542710 CAAGCTTGGCAGCTTCCACCTGG - Intergenic
936907994 2:117559352-117559374 CAATATTAACAACTCTCTCCTGG - Intergenic
937016111 2:118607538-118607560 CATTATTAACAGTTGTCACCTGG - Intergenic
939471298 2:142624532-142624554 CCATTTTGAGAGTTTTCACCTGG - Intergenic
940504013 2:154529430-154529452 CATTTTTGGCAGCTTTCTCCAGG + Intergenic
941285713 2:163610334-163610356 CTTTAATGACAGCCTTCACCAGG + Exonic
941542444 2:166803716-166803738 CAATGTTGACAGCTAACAGCTGG + Intergenic
942675970 2:178427302-178427324 CAATTTTTAAAGCTTCCACCTGG + Intergenic
942692480 2:178600911-178600933 CAGCATTGACAGCTTTGACTCGG + Exonic
943005511 2:182384783-182384805 CAATATTTACATCTTTCTCCAGG - Intronic
944095870 2:195967865-195967887 GAATATTGGCATCTTTCTCCAGG + Intronic
945273130 2:207961807-207961829 CAACACTGACAGCATCCACCTGG - Intronic
946112669 2:217433808-217433830 CACTATTCACACCTTTCACAAGG - Intronic
947118540 2:226796041-226796063 CAATATTGACATATTCCCCCGGG + Exonic
947130855 2:226923545-226923567 GAATATTGACATCTTTCTCTAGG + Intronic
947858072 2:233338037-233338059 AAACATTGACAGCTCTCACTTGG + Intronic
1168751390 20:284295-284317 CCATAGTTACTGCTTTCACCTGG - Intronic
1176246092 20:64097826-64097848 CAATATTTACATCTTTAACCTGG + Exonic
1177133533 21:17285845-17285867 CAATATTGGAAGTTCTCACCAGG + Intergenic
1177429976 21:20979635-20979657 CAATATTGATAGAATTCAGCAGG + Intergenic
1181627006 22:24129056-24129078 CAATAGTGACAGATGGCACCTGG + Intronic
950411540 3:12841170-12841192 CCAGCTTGACAGCTTTCAGCTGG - Intronic
956924526 3:73969502-73969524 CAATATTCTCAGTTTTCAGCTGG - Intergenic
958045811 3:88282390-88282412 AAATATTGTAAGCTTTCTCCAGG - Intergenic
961993510 3:131217055-131217077 CAATCTTAACTGCTGTCACCGGG + Intronic
963591968 3:147271270-147271292 GAATATTGATAACTTTCTCCAGG - Intergenic
967222058 3:187255723-187255745 CACTGTTGACAGCTTTCTCCTGG + Intronic
967237844 3:187405006-187405028 AAATATTGACAGCTTAGACAAGG + Intergenic
967677659 3:192318701-192318723 GAATATTGACATCTTTCTCTAGG - Intronic
970251846 4:14124960-14124982 CAATATTGACCTCTGTCCCCTGG + Intergenic
971683740 4:29736609-29736631 CAATATTGACAACTACCACAGGG - Intergenic
971954448 4:33397570-33397592 GAATATTGATACCTTTCTCCAGG - Intergenic
972807522 4:42545390-42545412 CAATATTTGGAGGTTTCACCAGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973650575 4:52993676-52993698 CAATATTGCCAACTTTTGCCTGG - Intronic
975069916 4:70121219-70121241 GAATATTTAGATCTTTCACCAGG - Intergenic
975991372 4:80263180-80263202 CAATATTTACAACATTCCCCTGG - Intergenic
979818478 4:125140564-125140586 AATGATTGACAGCTTTCAGCTGG + Intergenic
980399991 4:132270426-132270448 CAATATTGACATATTTCATTTGG + Intergenic
982347183 4:154372853-154372875 AAATATTGACAGTCTTCACAAGG + Intronic
982633461 4:157863163-157863185 CAATGTTGCCAGCTTTCTACTGG - Intergenic
982635534 4:157891859-157891881 CAATATATGCAGCTTTAACCCGG + Intergenic
982792156 4:159605867-159605889 TGATATAGACAGATTTCACCTGG - Intergenic
983318964 4:166170219-166170241 TAAAATTCACAGCTTTTACCAGG - Intergenic
985081513 4:186269959-186269981 GAATATTGAAAGCTTTCCCAAGG + Intronic
987537559 5:19208139-19208161 GAATATTGATATCTTTCTCCAGG - Intergenic
989323469 5:40163780-40163802 CAATATTGAATTCTTTCAGCTGG + Intergenic
991166340 5:63568185-63568207 AAATATTAACTGCTTTCCCCTGG - Intergenic
991186562 5:63815509-63815531 AAGTCTTGACAGCTTTCACATGG + Intergenic
993799097 5:92307983-92308005 AAATATTGTCACCTTTCATCTGG + Intergenic
995336557 5:111005893-111005915 AAATATTGACAGTTTTGTCCAGG - Intergenic
997071832 5:130631841-130631863 GAATATTGATAGCTTTCTCTAGG + Intergenic
997819470 5:137051359-137051381 CAATACCCAAAGCTTTCACCAGG - Intronic
1001123416 5:168998046-168998068 TATTATTGAGAGCTTCCACCTGG - Intronic
1011359561 6:86509338-86509360 GAATATTGACATCTTTCTCCAGG + Intergenic
1011908947 6:92410490-92410512 CAACTTTTACAGCTTCCACCTGG - Intergenic
1012571813 6:100738953-100738975 TAATATTGGAAGTTTTCACCAGG - Intronic
1014302825 6:119704688-119704710 AACTGTTGACAGCTTTCACAAGG - Intergenic
1014388119 6:120826089-120826111 TAATATTGGCAGCTTTATCCAGG + Intergenic
1015257479 6:131195971-131195993 GAATATTGACGTCTTTCTCCAGG + Intronic
1019719440 7:2559340-2559362 CAATAATGGCAGCTGTCACCCGG - Intronic
1020852185 7:13368434-13368456 GAATATTGACATCTTTCTCTAGG + Intergenic
1023685209 7:42726718-42726740 TAATATTGACAGCTTTTACCTGG + Intergenic
1026386023 7:69848608-69848630 CAATAATGACAGGGTTTACCTGG - Intronic
1030293177 7:107891796-107891818 CAGTGTTGGCAGCTTTCAACTGG + Intronic
1035157587 7:156926524-156926546 AACTACTGACAGGTTTCACCAGG - Intergenic
1039340359 8:36642277-36642299 AAACACTGACAGCTTTCATCAGG + Intergenic
1041657015 8:60362873-60362895 CAGTATTGACAGGATTCACTTGG + Intergenic
1044173064 8:89081201-89081223 CATTCTTGACAGCTTTGACTGGG - Intergenic
1045446225 8:102267417-102267439 CAATATTGACAGCTTTCACCTGG - Intronic
1048118942 8:131557028-131557050 GAATATTGACATCTTTCTCTAGG - Intergenic
1054958870 9:70944638-70944660 CCATGCTGACAGCTTACACCAGG + Intronic
1058683057 9:107456898-107456920 CAATAGAGACGGGTTTCACCAGG - Intergenic
1059541250 9:115132704-115132726 CACTATTGACATTTTTCAGCTGG - Intergenic
1060166511 9:121421543-121421565 GAATGTTGATATCTTTCACCAGG + Intergenic
1186491957 X:9980631-9980653 CAAGAGTGTCAGCATTCACCGGG - Intergenic
1187102451 X:16208087-16208109 CAAAATTGACCACTTTTACCTGG - Intergenic
1187901872 X:24033400-24033422 CAATATTGACATCTCTGGCCGGG - Intergenic
1188714720 X:33447898-33447920 CAGTCTTGACATTTTTCACCCGG - Intergenic
1189364947 X:40381010-40381032 CAATATTCAGAGCTTTCAGATGG - Intergenic
1193830790 X:86287412-86287434 CGATATTGATATCTTTCTCCAGG + Intronic
1194331381 X:92587044-92587066 CAATATTGACAGTCTTCAGTGGG + Intronic
1194954639 X:100164921-100164943 AAATATTGATAGCTTTCTCTAGG + Intergenic
1196105670 X:111892495-111892517 CAATATAGTTAGCTTTCGCCAGG + Intronic
1196343113 X:114620073-114620095 CAATATTTACAGCTGCCACTTGG - Intronic
1200640081 Y:5706102-5706124 CAATATTGACAGTCTTCATTGGG + Intronic