ID: 1045446869

View in Genome Browser
Species Human (GRCh38)
Location 8:102275652-102275674
Sequence CCTGATAAGCATGTATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045446869_1045446873 -6 Left 1045446869 8:102275652-102275674 CCCTGAAATACATGCTTATCAGG 0: 1
1: 0
2: 3
3: 23
4: 159
Right 1045446873 8:102275669-102275691 ATCAGGCAGAATGGAATTTAAGG 0: 1
1: 0
2: 2
3: 37
4: 277
1045446869_1045446874 19 Left 1045446869 8:102275652-102275674 CCCTGAAATACATGCTTATCAGG 0: 1
1: 0
2: 3
3: 23
4: 159
Right 1045446874 8:102275694-102275716 CACAAAATACATACTGATCCAGG 0: 1
1: 0
2: 3
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045446869 Original CRISPR CCTGATAAGCATGTATTTCA GGG (reversed) Intronic
901676955 1:10890913-10890935 CCTGTTAAGCCTGCATTACAGGG - Intergenic
906348057 1:45033336-45033358 TCTAATAAGCATGTATTTTTGGG + Intronic
908995564 1:70148853-70148875 TCTGTTTAACATGTATTTCAAGG - Intronic
909751033 1:79161168-79161190 TATGATAAGAATGTATTTAAAGG + Intergenic
910681929 1:89875472-89875494 TCTGATAAGCATGTGTTTCATGG + Intronic
912387421 1:109278789-109278811 CCTGATAAGCTGGAATCTCAAGG + Intergenic
915860577 1:159440177-159440199 CATAATAACCATGTATCTCAGGG - Exonic
916452261 1:164932173-164932195 CCTCATAAACTTGAATTTCAAGG + Intergenic
919828807 1:201523987-201524009 AATAATAAGAATGTATTTCAGGG + Intergenic
921574571 1:216819512-216819534 CCATATAAGCATGTCTTTTACGG + Intronic
921649907 1:217664878-217664900 CCTTATAAGCATTTATTTATAGG - Intronic
923863695 1:237917407-237917429 CCTGCTGAGCAGGTCTTTCATGG - Intergenic
1069255385 10:66325199-66325221 ACTGATAAGCATGTAGCTGAGGG - Intronic
1070871920 10:79762305-79762327 CCTGACAATCATCCATTTCAAGG - Intergenic
1071638837 10:87284477-87284499 CCTGACAATCATCCATTTCAAGG - Intergenic
1071656401 10:87453475-87453497 CCTGACAATCATCCATTTCAAGG + Intergenic
1072499536 10:95999249-95999271 CTTGACAGGCATGTTTTTCATGG - Intronic
1073573987 10:104605722-104605744 CCTGAAAACCATGTTTTACATGG - Intergenic
1074544442 10:114391737-114391759 CCTGGTAAGCACGTTTGTCAAGG - Intronic
1080210427 11:29779577-29779599 CCTCATAAGCCTCTAATTCAAGG + Intergenic
1081353086 11:42079534-42079556 CCTGACCTGCATGTATTTCAGGG + Intergenic
1085775073 11:79358336-79358358 CCTGATAATCATGGCTTTCCAGG - Intronic
1085775250 11:79359774-79359796 CCTGATAATCATGGCTTTCCAGG - Intronic
1086294061 11:85345641-85345663 CCAGTTAAGGATGTATTTTATGG - Intronic
1088438968 11:109847177-109847199 CCTGATAAACATGCATTGAATGG + Intergenic
1090118303 11:123998363-123998385 CCTGAGACACATGTGTTTCAGGG - Intergenic
1090573422 11:128072755-128072777 TCTGATAGTCATGTATTTCTTGG + Intergenic
1091454282 12:594229-594251 ACTAATAAGCAAGTATTACAAGG + Intronic
1095612150 12:44142226-44142248 CCTTATAAGCATGCAATTTATGG + Intronic
1097090243 12:56499078-56499100 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1097605915 12:61754194-61754216 CCTGATAACCATCTTATTCATGG - Intronic
1098064548 12:66599760-66599782 CCTTATAAGCATGAAATTCTAGG - Intronic
1107002584 13:35566754-35566776 TCTGATAACAATGCATTTCAAGG - Intronic
1110196199 13:72791352-72791374 CCTGAAATTCATGTATTTTAAGG + Intronic
1113499498 13:110761949-110761971 CCTGATACAACTGTATTTCAGGG + Intergenic
1113783638 13:112990366-112990388 CCAGAGAAGCCTGTTTTTCAAGG + Intronic
1115697814 14:35919639-35919661 CCTGCTAAGAATGTATTTTACGG - Intronic
1116438926 14:44928646-44928668 CCTGATAACCATGATTTTCTAGG - Exonic
1117306548 14:54482029-54482051 CATAATGAGCATGTATTTAAAGG + Intronic
1118408211 14:65448343-65448365 CCTGATAAGCATGAGTTTGATGG - Intronic
1119292789 14:73508953-73508975 TCTGATAAGCATGTATATATAGG + Intronic
1119293143 14:73511854-73511876 GCTGATAAGCATGTATATATAGG + Intronic
1119554793 14:75545038-75545060 TCTGATTAGCATGTATTTGATGG + Intronic
1125324949 15:38526906-38526928 CTGGAGAAGCATATATTTCAGGG - Intronic
1128625440 15:69197550-69197572 TTTGAGAACCATGTATTTCAAGG + Intronic
1128755564 15:70181289-70181311 CCTGATAAGCACAGATTTCTGGG + Intergenic
1132967719 16:2668334-2668356 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1134178101 16:12024999-12025021 CCTCATAAGCACATATTTTAAGG - Intronic
1137827325 16:51510443-51510465 CCTGATAAATCTCTATTTCAAGG - Intergenic
1139198716 16:64950691-64950713 TTTGAGAAGCATGTGTTTCAAGG + Intronic
1140156498 16:72433456-72433478 CCTTTTAAACATGTATTTAAAGG + Intergenic
1140298159 16:73728874-73728896 CCTGGTATGCATGATTTTCATGG - Intergenic
1142048175 16:87939650-87939672 CCTGATTACCATGTTCTTCAGGG + Intergenic
1144386007 17:14749966-14749988 GCTCATCAGCTTGTATTTCATGG - Intergenic
1146663082 17:34678137-34678159 CAGTATAAGCATGTATTTCATGG - Intergenic
1147837809 17:43347492-43347514 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1152206259 17:78976245-78976267 CCTGCTGAGCTTGTATTTCAGGG + Intronic
1158315647 18:56208989-56209011 CCAGATAGGCATGTACCTCAAGG + Intergenic
1158884631 18:61815591-61815613 CCTCATAATCATGTATTCAATGG - Exonic
1159112354 18:64074017-64074039 CCTGATGAGAATGTATTTTCTGG - Intergenic
1164084411 19:21888316-21888338 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1164286692 19:23823205-23823227 CCCGATTAGCATGTATGTTAAGG - Intronic
1166559773 19:43724665-43724687 CCTGATCACGATGTACTTCAAGG + Intergenic
1167886021 19:52500720-52500742 TCAGATAGGCATGTATGTCAGGG + Intronic
1167888051 19:52518101-52518123 TCAGATATGCATGTATGTCAGGG + Intergenic
1167916408 19:52743512-52743534 TCAGATAAGCATGTATGTCAGGG - Intergenic
926136503 2:10340393-10340415 CTTGATAAACATGTTTTCCAGGG + Intronic
933887440 2:86732129-86732151 CGTGGGCAGCATGTATTTCATGG + Intronic
933922735 2:87064584-87064606 CGTGGGCAGCATGTATTTCATGG - Intergenic
935171571 2:100614532-100614554 CCTGCTAAGAATCTATTGCAAGG - Intergenic
936293410 2:111246705-111246727 CCTGGTAAACATGTTTTTCTTGG + Intergenic
938179520 2:129167761-129167783 AATGATAACCATGTATTTTATGG + Intergenic
939699672 2:145374581-145374603 CCAGGTAAGCCTGTATTTGAAGG - Intergenic
940267086 2:151850090-151850112 AAAGATAAGTATGTATTTCATGG - Intronic
940361215 2:152798161-152798183 CCTAGGAAGCATGGATTTCAAGG + Intergenic
941315655 2:163989392-163989414 CCTCATTAGCATGATTTTCAAGG - Intergenic
941621356 2:167782827-167782849 CCTTATAAACATGGCTTTCAAGG - Intergenic
942643327 2:178083944-178083966 ACTGATAAGTATGTGTTTCTTGG - Intronic
942665542 2:178312787-178312809 CCTGATCAGTATATATTTTATGG + Intronic
946535346 2:220621350-220621372 ACAGATAAGCATGTAAATCAAGG - Intergenic
946646650 2:221844579-221844601 CCTCATATGCATGAATTTCATGG + Intergenic
946806899 2:223479841-223479863 CCTGAGCAGTATTTATTTCATGG + Intergenic
946851863 2:223915539-223915561 TCTAATGAGCATGAATTTCAAGG + Intronic
947286451 2:228521420-228521442 CCTGATACCCATGTAGTTCAAGG - Intergenic
1169053928 20:2604351-2604373 AGTGATAAGCATGTATATAATGG - Intronic
1169436050 20:5591819-5591841 CATGGTAAGTATGTTTTTCATGG - Intronic
1169730016 20:8776682-8776704 TCTAATAAGCATTTGTTTCAAGG - Intronic
1173187555 20:40852527-40852549 CCTTATAGGCATGAATTGCAAGG + Intergenic
1173730699 20:45326474-45326496 CCTGCTAAGTTTGTATTTAATGG - Exonic
1174884092 20:54312518-54312540 CCTGATAGACATGAATTTTAGGG - Intergenic
1177406167 21:20671309-20671331 CCTGATTAGCTTTTATTTCTAGG - Intergenic
1179302019 21:40120842-40120864 GCTGATAGGCATTTATTTCATGG - Intronic
1185094590 22:48799454-48799476 CCTGCCAAGCATGTATTTGTGGG - Intronic
949138072 3:595520-595542 CTTGCTAAGCATTTATTTCAAGG - Intergenic
950352108 3:12365391-12365413 CCAGATAATCAGTTATTTCATGG + Intronic
951349474 3:21588009-21588031 CATTATAAGCATGTAGTCCATGG + Intronic
951351744 3:21614886-21614908 CCTGATAAAACTGTACTTCAGGG - Intronic
952311664 3:32196144-32196166 GTTGATAAGCATGAATTTTAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953147072 3:40288400-40288422 CCTGGTAAGTGTGTATTTCATGG - Intergenic
953613113 3:44464289-44464311 CCAGGAAAGCATGTATTTCTAGG - Intronic
954158501 3:48702321-48702343 CCTGATACACATGTACCTCAGGG + Intronic
960386814 3:117030214-117030236 CCAGAAAAGCATGTGTTTCTAGG - Intronic
962194735 3:133351687-133351709 CTTCATAAGCCTCTATTTCATGG + Intronic
964016582 3:151954611-151954633 CATGATAAACATGTTGTTCAGGG + Intergenic
964099213 3:152968566-152968588 ACTTATAAGCATCTATTTCCAGG + Intergenic
964333514 3:155629877-155629899 GCTGAGAAGCAAGTATTTCAGGG - Intronic
966525720 3:180916957-180916979 CCTGAGTAGCTGGTATTTCAGGG + Intronic
969734956 4:8981741-8981763 CCTGACAAGGATGTCTTTCTTGG + Intergenic
971169828 4:24222045-24222067 CAAGAGAAGCATGTAATTCAGGG + Intergenic
971234817 4:24831244-24831266 ACTGAGTAGTATGTATTTCATGG - Intronic
973579710 4:52331214-52331236 CCAGACAGGCATGCATTTCATGG + Intergenic
977684456 4:99832365-99832387 TCTGATGAGCATTTCTTTCAGGG - Intronic
980941922 4:139282985-139283007 CCTGATAAGCATATTTTTCATGG + Intronic
981260866 4:142717166-142717188 TCTCATTAGCATGTATTTCAAGG - Intronic
981673444 4:147313758-147313780 CCAGAGAAACATGGATTTCATGG + Intergenic
982305905 4:153930403-153930425 CCTTAAAAACATGAATTTCAAGG - Intergenic
984540633 4:181033036-181033058 CCTGAAAAGCATTTATTTAAAGG - Intergenic
984837024 4:184031845-184031867 CCTGACATGCATGGTTTTCATGG - Intergenic
993734205 5:91456802-91456824 CCAGATAAAAATGTTTTTCAGGG - Intergenic
994598278 5:101867611-101867633 CCTGATAACCATGGTTTTCTTGG + Intergenic
995377947 5:111498969-111498991 CTTGTTTAGCATGTATTTCAGGG + Exonic
995647978 5:114334874-114334896 CCTGAAATTCATGTGTTTCAAGG + Intergenic
995765160 5:115606631-115606653 CCAGATAACCATCCATTTCAAGG + Intronic
996115837 5:119617332-119617354 CATGATAAGATTGTATTTCCTGG + Intronic
996566696 5:124887115-124887137 CCTTAAAAGTATATATTTCAAGG + Intergenic
1004273407 6:14214274-14214296 ACTGGAAAGCATGTATTCCAAGG + Intergenic
1004805824 6:19202625-19202647 GGTGAAAAGCATGTATTACATGG + Intergenic
1004866518 6:19858243-19858265 CCTGATAATCATTTATTCCATGG + Intergenic
1005392226 6:25345218-25345240 CCTGTAAAGAATGTATTTCATGG - Intronic
1005524065 6:26628192-26628214 CCTGAGTAGCAGGGATTTCAGGG - Intergenic
1006992812 6:38229897-38229919 CCCGAGAAGCATGCCTTTCAGGG + Intronic
1007593662 6:43038471-43038493 AGTGATCAGCATTTATTTCAGGG - Exonic
1007804809 6:44434312-44434334 CCTGGTTAGCATGCTTTTCAGGG + Intronic
1008029695 6:46680548-46680570 CCTGTGAAGAATGGATTTCAGGG - Intergenic
1008336204 6:50307713-50307735 GCTGATATGCATGTAGTTGAGGG - Intergenic
1008453806 6:51685053-51685075 CTGGAAAATCATGTATTTCAGGG - Intronic
1008473557 6:51911253-51911275 CCTATTAAGCATCTATTTCAGGG - Intronic
1009572782 6:65410146-65410168 CCTTATAAGTATGTAATTCTTGG + Intronic
1012268415 6:97176359-97176381 CCTAAAAAACATGTATTTCTCGG + Intronic
1012888338 6:104871062-104871084 GCTGCTAAGCATGTCATTCAAGG - Intergenic
1015286518 6:131491512-131491534 TCAAATATGCATGTATTTCAGGG + Intergenic
1016717983 6:147255906-147255928 CATGATAAGCAGGTATTTTTTGG + Intronic
1019425295 7:973020-973042 TCTGATAAGCCTCCATTTCAAGG + Intronic
1021309372 7:19073979-19074001 CCTGAGCAGCATGTATGTTATGG - Intronic
1021537274 7:21720092-21720114 CCTGAACAGCATTTCTTTCAAGG + Intronic
1031212292 7:118846047-118846069 CATGATAATCAAGTGTTTCATGG - Intergenic
1031383217 7:121113734-121113756 CCTGAAGAGCTTGAATTTCATGG + Intronic
1031470090 7:122158389-122158411 CCTGATAAGTCTGTAACTCATGG + Intergenic
1031651520 7:124296850-124296872 CCTGTAAAGCATGCATTGCAAGG - Intergenic
1033710946 7:143943123-143943145 GCTGATAAAGATGTAGTTCAAGG - Intergenic
1034130562 7:148712280-148712302 TCTGTTAAACATGTATTTCATGG + Intronic
1036517012 8:9453569-9453591 CCTGATAAACTTGTGCTTCAAGG - Intergenic
1037417730 8:18669342-18669364 CCTTATAAGCATGTAAGTCTAGG - Intronic
1037521652 8:19685749-19685771 TCTGACAGGCAGGTATTTCAAGG + Intronic
1038483521 8:27918147-27918169 CCTGAAAAGGGGGTATTTCATGG + Intronic
1045446869 8:102275652-102275674 CCTGATAAGCATGTATTTCAGGG - Intronic
1045584724 8:103520704-103520726 TTTGAGAAGTATGTATTTCAAGG + Intronic
1045630030 8:104108020-104108042 CTTCATAATAATGTATTTCATGG + Intronic
1048222644 8:132556103-132556125 CTTTAAAAACATGTATTTCATGG + Intergenic
1048830369 8:138470957-138470979 AGTGAGAGGCATGTATTTCAGGG - Intronic
1049880428 8:145058327-145058349 CCTGCTAAGCAGGTCTTTCATGG - Intergenic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1050415940 9:5418105-5418127 CCTCATAATCATGTATTCAATGG - Intronic
1052073830 9:24116668-24116690 CCTGATAAGAATATATATGAAGG + Intergenic
1052425671 9:28301758-28301780 CCTGATGATTATGTATTTTAGGG - Intronic
1054935577 9:70684159-70684181 CCTGATAATCTTGTATTTCAGGG - Intronic
1056683457 9:88740126-88740148 CTTAGTAACCATGTATTTCAAGG - Intergenic
1057635647 9:96763693-96763715 CCTGATAAGAATTGTTTTCATGG - Intronic
1058564449 9:106266860-106266882 CCAGATAAGCATGAATTTGAGGG - Intergenic
1058583529 9:106483598-106483620 CCTGTTAGGGATGTTTTTCAAGG - Intergenic
1203619241 Un_KI270749v1:104824-104846 TTTGCTAAGCATTTATTTCAAGG + Intergenic
1185849048 X:3468350-3468372 CCTGAGAAGCATGGATGTGATGG - Intergenic
1186144033 X:6607111-6607133 ACTGATTTGCATGGATTTCAGGG - Intergenic
1187741825 X:22364350-22364372 CTTGAAAAGTATATATTTCAGGG + Intergenic
1190988802 X:55524327-55524349 ACTGAAAAGCATTTATTACATGG + Intergenic
1194051104 X:89070229-89070251 CCTCATCAGCTTTTATTTCAGGG - Intergenic
1194338927 X:92685208-92685230 CAGTATAAGCATGTATTTTAAGG - Intergenic
1197252005 X:124226469-124226491 CCTGACAAGCATCAATTTAAGGG - Intronic
1198384459 X:136115240-136115262 CCTGTTATGCATGTAAATCATGG + Intergenic
1199153943 X:144524431-144524453 CCTGAAAGGCATGTCTTACATGG + Intergenic
1200647320 Y:5801986-5802008 CAGTATAAGCATGTATTTTAAGG - Intergenic
1201707725 Y:16955130-16955152 CCTGCTGAGCAGGTCTTTCATGG - Intergenic
1201770978 Y:17616584-17616606 CCTGATAAGCTGGGATTACAGGG + Intergenic
1201830577 Y:18289402-18289424 CCTGATAAGCTGGGATTACAGGG - Intergenic
1202039585 Y:20668044-20668066 ACTGAGAAGCATGTAGTTCTGGG - Intergenic