ID: 1045454723

View in Genome Browser
Species Human (GRCh38)
Location 8:102366434-102366456
Sequence CTGTATCCAGAAAAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045454723_1045454727 7 Left 1045454723 8:102366434-102366456 CCCCTCTGCTTTTCTGGATACAG 0: 1
1: 0
2: 3
3: 31
4: 278
Right 1045454727 8:102366464-102366486 AACGAAAAAAAGTACATTACTGG No data
1045454723_1045454728 27 Left 1045454723 8:102366434-102366456 CCCCTCTGCTTTTCTGGATACAG 0: 1
1: 0
2: 3
3: 31
4: 278
Right 1045454728 8:102366484-102366506 TGGTACGTAACTTATTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045454723 Original CRISPR CTGTATCCAGAAAAGCAGAG GGG (reversed) Intronic
900075982 1:818141-818163 CTTTATACACAAAAGCAGACGGG + Intergenic
901314253 1:8295108-8295130 GTCTACCCAGGAAAGCAGAGAGG + Intergenic
901599883 1:10415136-10415158 CTGTATCCAGAGGAGCAAACAGG - Intronic
901685983 1:10943614-10943636 ATGTAACCAGAGAAGCAGTGTGG - Intergenic
901810386 1:11764080-11764102 CTGTATGCAGATCAGCCGAGAGG + Intronic
903221924 1:21873983-21874005 CTGTGTCCAGAAAACAAGTGTGG + Exonic
903745043 1:25581263-25581285 CTGAATTCTGAGAAGCAGAGAGG + Intergenic
903813475 1:26047312-26047334 CAGAGTCCAGAGAAGCAGAGAGG - Intergenic
908140166 1:61176063-61176085 ATGTGTAAAGAAAAGCAGAGAGG + Intronic
908338394 1:63150621-63150643 ATTTACCCAGAGAAGCAGAGGGG - Intergenic
908398294 1:63746335-63746357 AGGTCTCCAGACAAGCAGAGGGG - Intergenic
912516677 1:110220665-110220687 CTCTCTCCTGAAAAACAGAGTGG - Intronic
914927766 1:151903786-151903808 CTGTATCCATAAAAGGACAGTGG - Intronic
915250219 1:154582747-154582769 CTGTAGCCTGAAGAGGAGAGGGG + Exonic
915255080 1:154622118-154622140 CTATGTCCTGAAAAGCAGAGTGG + Intronic
915513928 1:156401896-156401918 CTGTATGCAGATGAGGAGAGAGG - Intergenic
919366044 1:196662268-196662290 CAGTGTCCAGAAAAACAGAAAGG - Intronic
920390298 1:205595973-205595995 CAGAATCTAGAAAAGCAGAGAGG + Intronic
920933863 1:210412887-210412909 CTGCAACCAGAAAAGCTGTGAGG - Intronic
921330475 1:214030661-214030683 CTGTCTCCAGAAAATAGGAGAGG + Intronic
922613203 1:226944947-226944969 CTGTCTTCAGAAAGGCAGAGAGG - Intronic
922678422 1:227568548-227568570 CTGTATACAGCAAAGGAAAGTGG - Intronic
922939958 1:229454425-229454447 CTGTACCTAGAAAATCAGACTGG + Intronic
924003599 1:239581837-239581859 TTCTATTCAGAAAAGCAAAGTGG - Intronic
924556371 1:245122462-245122484 CTGTCTCCAGAAAAAAAGTGGGG - Intronic
924942825 1:248824408-248824430 TTCTTTCCAGATAAGCAGAGGGG - Intronic
1064142494 10:12802447-12802469 CTGTCTTCAGAAATGCAGACTGG + Intronic
1064705372 10:18067310-18067332 CTGGATCCATAAAAGAAGCGAGG - Intergenic
1065017252 10:21473589-21473611 CTGGATCCAGAGATCCAGAGAGG - Intergenic
1065960184 10:30727752-30727774 CAGTGTCCAGCAAAGGAGAGAGG + Intergenic
1066196028 10:33100979-33101001 AAATATTCAGAAAAGCAGAGAGG - Intergenic
1066325673 10:34355329-34355351 CTGTCTCCAAAAAAGAAAAGAGG + Intronic
1067285365 10:44903871-44903893 GTGTTCCCAGCAAAGCAGAGAGG - Intergenic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1067777685 10:49175250-49175272 AGGTTTTCAGAAAAGCAGAGGGG + Intronic
1067828588 10:49597096-49597118 CAGGATCCAGGAAAGCACAGAGG - Intergenic
1067876987 10:50016214-50016236 CTGTATCCAGGAAAGGAGGCCGG - Intergenic
1069185381 10:65416283-65416305 CAGTGTCCAGAAATGCAGACCGG - Intergenic
1069767857 10:70876983-70877005 CTTTATGCAGAAAGGCAGACTGG + Intronic
1070513399 10:77181225-77181247 GAGGATCCAGAAAAGCAAAGTGG + Intronic
1072661248 10:97364836-97364858 CTGAATCCTGAAGAGCAGGGGGG + Intronic
1072732019 10:97852675-97852697 CTGTATTGAGAGAAGGAGAGAGG + Intronic
1073286256 10:102390863-102390885 CTGTCTCAAAAAAAGAAGAGTGG - Intergenic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1074313783 10:112344201-112344223 GTGTATGCAGAAAGGCAGTGTGG - Intergenic
1076926755 10:133494574-133494596 CTGTATCCTGCAAAGCCAAGGGG - Intergenic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1080044076 11:27790060-27790082 TTGGATACAGAAAAGCAGAGGGG + Intergenic
1083893659 11:65609616-65609638 CTGTAACCTGAAAAGTAGAGGGG - Intronic
1085821805 11:79801824-79801846 TTGTTTACAGAAAAGGAGAGAGG - Intergenic
1088082106 11:105931021-105931043 CTGTATCAAGTGAATCAGAGAGG + Intronic
1089970506 11:122689421-122689443 TTGTGTCCTGAATAGCAGAGTGG + Intronic
1091397126 12:160776-160798 CTGAACCCAGACCAGCAGAGAGG - Intronic
1091971942 12:4794714-4794736 CTGCATTCAGGAAAGCAGATGGG + Intronic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1092999843 12:13983848-13983870 CTGAATACAGAAAATGAGAGTGG - Intergenic
1093435733 12:19131496-19131518 CATTATCCATAAAAGCAAAGAGG - Intronic
1094048413 12:26193716-26193738 CTCTTACCAGAAAAACAGAGTGG - Intronic
1094090504 12:26644275-26644297 CTGTGTCCAGCAAAGCTGTGGGG + Intronic
1096668348 12:53181654-53181676 CTGAAACCAGAAAGGAAGAGGGG - Intronic
1097718488 12:62994403-62994425 AAGTATACAGAAAAGTAGAGAGG + Intergenic
1098648730 12:72939031-72939053 CTGTACCCAGAAAAGCCAAAGGG - Intergenic
1099347065 12:81514804-81514826 TTGTATCAAGGAAAGCACAGTGG - Intronic
1099407501 12:82281998-82282020 CTGTATCCTGAAAAGCAATAGGG + Intronic
1102413392 12:112739688-112739710 CTGTAATCAGAAAAGAACAGAGG - Intronic
1102715638 12:114969635-114969657 CTGCATCCAGAACAGCAGGAAGG + Intergenic
1104500533 12:129281635-129281657 CTGAATACAGATAAGCAGTGTGG - Intronic
1107240192 13:38223671-38223693 CTGAATCCACAAAAGCAGAGTGG - Intergenic
1109183873 13:59246727-59246749 GTATAACCAAAAAAGCAGAGGGG + Intergenic
1111254925 13:85654033-85654055 CTGTCCACAGAAAAGCAGTGAGG - Intergenic
1111651361 13:91094573-91094595 GTGTAGAGAGAAAAGCAGAGGGG - Intergenic
1111877168 13:93911891-93911913 CAGTATGCAGAAAGGCATAGTGG + Intronic
1112254571 13:97817953-97817975 GAGTATGCAGAAAATCAGAGAGG - Intergenic
1112950156 13:104984702-104984724 GGGGATGCAGAAAAGCAGAGAGG + Intergenic
1114701243 14:24680678-24680700 CTTTAGCCACAAAGGCAGAGTGG - Intergenic
1118730975 14:68666165-68666187 CTGAAGCCAGCATAGCAGAGAGG + Intronic
1119085356 14:71733875-71733897 GTGTGTCCAGAGAAGTAGAGTGG - Intronic
1120263423 14:82218097-82218119 GTTTATCCAGAAAAGAAGAATGG + Intergenic
1120624236 14:86804574-86804596 CTATATCCAGTAATGAAGAGAGG + Intergenic
1120763456 14:88306657-88306679 ATGTCTCCAGAAAAGCACTGGGG + Intronic
1121904630 14:97728404-97728426 TTGTGTCCAGAAAAGCAGAAAGG + Intergenic
1123797795 15:23790818-23790840 AAGTATCCTGTAAAGCAGAGGGG + Intergenic
1124506249 15:30276826-30276848 CTTTCTCCATAAAAGCAGATAGG + Intergenic
1124569390 15:30848252-30848274 CTGTATACAGAGTACCAGAGCGG + Intergenic
1124737307 15:32261810-32261832 CTTTCTCCATAAAAGCAGATAGG - Intergenic
1125382985 15:39107023-39107045 CTATACCATGAAAAGCAGAGAGG - Intergenic
1126968504 15:54083544-54083566 CTGTATCCACAATAGTAGATGGG + Intronic
1128079624 15:64848649-64848671 CTGGATCAAGAAGAGCAGTGGGG + Exonic
1130283677 15:82538698-82538720 CTGGTTCCAGAAGAGCAGAATGG + Intronic
1130690237 15:86075950-86075972 CTGTAACCAAAATAGCAGTGAGG - Intergenic
1132133169 15:99304269-99304291 TTGTATCCAGATAATCACAGGGG - Intronic
1132349386 15:101129522-101129544 CTGTAGCCTCAAAGGCAGAGAGG - Intergenic
1134075266 16:11286460-11286482 CTGTCTCAAGAAAAGAAAAGAGG + Intronic
1134317541 16:13133043-13133065 CTGTAGCTAAAAAAGCAAAGAGG + Intronic
1134573282 16:15309865-15309887 CTGTTTCCAGGAAAGCAGAATGG - Intergenic
1134729099 16:16446093-16446115 CTGTTTCCAGGAAAGCAGAATGG + Intergenic
1134938335 16:18265772-18265794 CTGTTTCCAGGAAAGCAGAATGG - Intergenic
1135800025 16:25485112-25485134 AGGTATCCAAATAAGCAGAGAGG - Intergenic
1135829253 16:25759052-25759074 CTGTAGCCAGGGAAACAGAGGGG + Intronic
1138119682 16:54389608-54389630 CTGGAGCCAGGAATGCAGAGAGG - Intergenic
1138480147 16:57297373-57297395 CTGCCTCCAGAGAAGCAGAGAGG + Intergenic
1139211259 16:65079629-65079651 CTGAATCAAGAAAGGTAGAGAGG - Intronic
1140080979 16:71747248-71747270 CTTTATTCAAAAAAGCAAAGAGG + Intronic
1140507276 16:75481754-75481776 ATGGAGCCAGAGAAGCAGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141220041 16:82060849-82060871 CTGTGGCTAGAAAAGCAGTGAGG + Intronic
1143270522 17:5671685-5671707 CTGTGTCCAGCAATGGAGAGGGG - Intergenic
1143271477 17:5678669-5678691 TTGTATCCAGCAAAGCTGTGAGG + Intergenic
1147359949 17:39924213-39924235 TTGTTTGCAGAACAGCAGAGAGG - Exonic
1147555144 17:41473919-41473941 CTGTTTCAACAAAAGCAGATAGG + Intergenic
1148406163 17:47418380-47418402 ATGTATCCAGAAAATCACTGAGG - Intronic
1148582094 17:48751323-48751345 CTGCAGACAGAGAAGCAGAGTGG - Intergenic
1149358249 17:55866656-55866678 CTGTTTCCAGGAAACCACAGAGG - Intergenic
1150180692 17:63117472-63117494 TTGTATCCAGAGAAGCACTGTGG - Intronic
1150568541 17:66364509-66364531 CTGTATGGAGAAGAGGAGAGAGG + Intronic
1150917519 17:69451706-69451728 CCCTATCCAGAGAGGCAGAGAGG + Intronic
1154113881 18:11593961-11593983 CTGAACCCCAAAAAGCAGAGAGG - Intergenic
1155659948 18:28237021-28237043 ATGAAGCCAGAAAAGCCGAGTGG - Intergenic
1156525876 18:37766726-37766748 CTGTATCCAGCAAAGCTTTGGGG - Intergenic
1157376710 18:47174124-47174146 CGCTATCCAGAAAAGTAGAAGGG - Intronic
1158057097 18:53294377-53294399 CAGTATCCAGAGAAGTGGAGTGG + Intronic
1158216788 18:55108995-55109017 CATTATCCTGAAAAGAAGAGGGG - Intergenic
1158620285 18:59026987-59027009 CTGTCTCCAAAAAAACAGGGCGG - Intergenic
1159790892 18:72777819-72777841 CTGTTCCCAGAAAAGCAGTTGGG - Intronic
1164727718 19:30477689-30477711 CTGTCTTCAGCAAAGCACAGTGG - Intronic
1166784486 19:45359435-45359457 CTGTACCCAGGAAACCAGATCGG - Intronic
925803374 2:7624714-7624736 CTTTAGACAGAGAAGCAGAGGGG - Intergenic
926018662 2:9475401-9475423 CGGTAACCAGCAAAGCAGTGAGG + Intronic
926119639 2:10235081-10235103 ATGTCTCCAGAAAAGTAGGGAGG - Intergenic
927074055 2:19559319-19559341 CTGTATTCAGACACACAGAGAGG + Intergenic
927143500 2:20145469-20145491 CAGAATCCAGCAAAGCACAGAGG - Intergenic
927990465 2:27443382-27443404 CTGTATCCTGAAAAGCAAGAAGG - Exonic
927990838 2:27445789-27445811 CTGTATCCTGAAAATCAGAGTGG + Exonic
928388102 2:30886467-30886489 CTGTGTCCAGCCAGGCAGAGAGG - Intergenic
930956661 2:57211109-57211131 CTGCATGTAGAATAGCAGAGAGG + Intergenic
932955123 2:76343018-76343040 CTGTAACCAGAAATTCAGATTGG + Intergenic
932987749 2:76747387-76747409 CTGTCACCAGAACAGCACAGGGG + Intergenic
933774072 2:85761283-85761305 CTGTACACACAAAAACAGAGAGG - Intronic
934663737 2:96156555-96156577 TTTAAACCAGAAAAGCAGAGAGG + Intergenic
935469966 2:103447098-103447120 CTGTATCCTAAAATGAAGAGTGG - Intergenic
936094528 2:109521726-109521748 GTGTATCCAAGAAAGCAGGGTGG + Intergenic
937881908 2:126874534-126874556 GTGTCTCCAGAAAAACAGATAGG + Intergenic
938367327 2:130745060-130745082 CCGTCTCCAGAGAAGCTGAGTGG + Intergenic
938498887 2:131819903-131819925 ATGCATCCAGAAGAGCAAAGCGG - Intergenic
938672187 2:133597158-133597180 CAGCATCCGGCAAAGCAGAGTGG + Intergenic
938683591 2:133716007-133716029 CTGGGTACAGCAAAGCAGAGGGG + Intergenic
941878024 2:170454605-170454627 CTGGATCCATCAAAGGAGAGGGG + Intronic
942157789 2:173149325-173149347 TTGGATCCTGAAATGCAGAGAGG + Intronic
942783310 2:179671784-179671806 CTGCAGCCAGCAAAGCAGTGGGG + Intronic
943057678 2:183002917-183002939 CTGTTTCCAGAAGAGCTCAGGGG - Intronic
943066465 2:183091732-183091754 CTGCATGCAGAAAAGGTGAGGGG + Intronic
943448397 2:188018592-188018614 CTATCACCAGAACAGCAGAGGGG - Intergenic
943555884 2:189403373-189403395 GTGTATTCAGATAAGAAGAGAGG - Intergenic
945015348 2:205509351-205509373 ATGTGTCCAGAAAAGAAGGGAGG - Intronic
945332017 2:208551019-208551041 CTGTATCTAGGAAAGAAGAAAGG - Intronic
948316901 2:237034822-237034844 CTGTATTGAGAAAAGGGGAGGGG - Intergenic
1169021322 20:2333218-2333240 CTGTCTCCAGAGAAACTGAGAGG + Intronic
1169190738 20:3657824-3657846 CTGTAACAAGCAAATCAGAGTGG - Intergenic
1170357502 20:15508231-15508253 CTGTATCTAGATAAACAGAATGG + Intronic
1171968948 20:31551402-31551424 CTGTGTCCAGAAAAAGAAAGGGG + Intronic
1175616313 20:60402572-60402594 CTACATACAGCAAAGCAGAGTGG + Intergenic
1175731889 20:61359670-61359692 CTTTAGCAAGAAAGGCAGAGAGG + Intronic
1177114401 21:17067797-17067819 CGGTGTCCTGAAAAGAAGAGTGG + Intergenic
1177668170 21:24188852-24188874 CAGTTTCCAGAAGAGCAGAGTGG - Intergenic
1178529147 21:33360512-33360534 ATGTATCCAGAAAATCTGGGAGG - Intergenic
1179593151 21:42424516-42424538 CTCTGTCCAGGAGAGCAGAGGGG + Intronic
1179927876 21:44548216-44548238 CTGTTGCCAGGGAAGCAGAGGGG - Intronic
1180945316 22:19689253-19689275 CTGCATCCAGCCAAGCTGAGGGG - Intergenic
1183091129 22:35522941-35522963 CTGGATCCAGAAAGAAAGAGAGG - Intergenic
1183151782 22:36043374-36043396 TTGAATTCAGAGAAGCAGAGAGG + Intergenic
1183402505 22:37612942-37612964 CTGAATCCAGAAATGGATAGTGG - Intronic
1183738881 22:39659189-39659211 CTTTGTCCAGAGAAGCACAGTGG - Intronic
1183881138 22:40831396-40831418 CTGTATCCATAAAATGGGAGAGG + Intronic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
951669579 3:25165313-25165335 ATGTATACAGAAAAGCAAGGTGG - Intergenic
952533217 3:34283679-34283701 CTGGATTGAGAAAAGCAGGGAGG - Intergenic
952610141 3:35198943-35198965 CTTTGACCAGAAAAGCAGAAAGG + Intergenic
952953595 3:38543193-38543215 CTCCTTCCAGAAAAACAGAGTGG + Intergenic
953932164 3:47010854-47010876 CTTCATCCAGAAATTCAGAGAGG - Intergenic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
954934328 3:54313021-54313043 CTGTAGCCAGAAATGCCAAGAGG + Intronic
955322216 3:57982529-57982551 CTTTGTCCAGGGAAGCAGAGGGG - Intergenic
957515402 3:81244317-81244339 ATTTATCCAGAAGAGCAGAGAGG + Intergenic
959514692 3:107251669-107251691 ATCTATCCAGAAAAGCCCAGTGG + Intergenic
960613856 3:119579697-119579719 CTGTCCCCAGATAAGCAGGGTGG - Exonic
961033900 3:123629138-123629160 CTGTACCCAGAAAATAAGAAGGG + Intronic
962230825 3:133663960-133663982 GTGTCTCCAGATAAGCAGAGAGG + Intergenic
962235844 3:133706396-133706418 GTGCCTCCAGATAAGCAGAGAGG + Intergenic
963650177 3:147969211-147969233 CTGTCTCAAGAAAAGAAAAGAGG + Intergenic
964055751 3:152454794-152454816 CAGTATCTAGGAAATCAGAGTGG - Intronic
965425418 3:168516873-168516895 CTTTATCCAGAAAACCATAGAGG + Intergenic
966152700 3:176881959-176881981 GTGTATCCAAATAAGAAGAGAGG + Intergenic
967301588 3:188019681-188019703 CTATATCCAGCACAGAAGAGAGG + Intergenic
969824078 4:9742957-9742979 CTGTCTTAAGATAAGCAGAGAGG - Intergenic
969884084 4:10199947-10199969 CTGGATCCAGAAAAGCAGGAAGG - Intergenic
970460998 4:16274912-16274934 CTGTAACCTGCAAAGTAGAGAGG + Intergenic
970515746 4:16828410-16828432 AGGTATCCAGAAAAGCACACTGG - Intronic
972823734 4:42732548-42732570 CCGTATAAATAAAAGCAGAGAGG - Intergenic
975500721 4:75081340-75081362 CTTTATCCACAAGAGCAGAGTGG + Intergenic
976741061 4:88358097-88358119 CTGCTTCCAAAAAAACAGAGCGG + Intergenic
976878535 4:89889391-89889413 CCTTATCCACAAGAGCAGAGTGG - Intronic
976994108 4:91408241-91408263 CTGTATCCATAAAAGGTAAGAGG - Intronic
979700302 4:123659198-123659220 CTGTATCCTGAAATGATGAGTGG - Intergenic
981021724 4:140036266-140036288 ATGTATCCAGGAAAGCAGTGAGG - Intronic
981152770 4:141398340-141398362 CTGAATGCAGAGAAACAGAGGGG - Intergenic
981269357 4:142826622-142826644 CTGTAACCAAAATATCAGAGAGG - Intronic
981420700 4:144546878-144546900 CTGTATCCATTAAAACAGTGAGG - Intergenic
981488686 4:145316671-145316693 AGATATCCAGAAAAGCAGATGGG + Intergenic
982483028 4:155934557-155934579 CTGTACCCTGCAAAGCACAGAGG + Intronic
982745501 4:159102079-159102101 CTGGGACCAGAACAGCAGAGTGG + Intergenic
983329922 4:166312472-166312494 CTCTATTCAGAAAAGAAGAAAGG - Intergenic
983900614 4:173129365-173129387 CTCTATTCAGAAAAGCTGAATGG + Intergenic
984213938 4:176884388-176884410 CTGTCTCCACAACATCAGAGAGG - Intergenic
985685588 5:1279970-1279992 GTGCCTCCAGAAAAGCAGCGTGG - Intronic
986309336 5:6540333-6540355 CTGGATGCAGAAAATCAGAATGG - Intergenic
986772313 5:10985428-10985450 ATGAATCCAGAAAAGGAGGGTGG + Intronic
988805181 5:34733754-34733776 CTGTATCCAGCTGAGCAGAGAGG - Intronic
992854810 5:80849213-80849235 CTGTACCCTGCAAAGCACAGGGG - Intronic
993875516 5:93302421-93302443 CTCCAGACAGAAAAGCAGAGGGG - Intergenic
994503644 5:100612083-100612105 ATGAATCCAGAAGAACAGAGTGG + Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
994923058 5:106077074-106077096 CTGCTTCCAGTAGAGCAGAGAGG + Intergenic
995310796 5:110708117-110708139 CTCTCTGCAAAAAAGCAGAGGGG + Intronic
999262725 5:150247594-150247616 CTGTACCCAGAAGTGAAGAGAGG - Intronic
999297964 5:150472471-150472493 CTCTACCCAGCAAAGGAGAGGGG - Intergenic
1000898221 5:166882061-166882083 CTTTATACAGAAAATCAGTGCGG + Intergenic
1001474721 5:172042375-172042397 CCCCATCCAGAAAAGCACAGGGG + Exonic
1001522943 5:172407893-172407915 CTGTAGCCAACAAAGCGGAGGGG + Intronic
1001583282 5:172815005-172815027 CTATATAAAGAAAAGCAAAGGGG + Intergenic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1001918319 5:175580495-175580517 TTCTTTCCAGAAAAGTAGAGAGG - Intergenic
1002361105 5:178671683-178671705 TTCTTTTCAGAAAAGCAGAGGGG + Intergenic
1003191188 6:3876295-3876317 CTGTTTCCAGTAAAGCAATGGGG + Intergenic
1005448951 6:25954515-25954537 CTGTAGGCAGAACAGCAGCGTGG + Intergenic
1006044677 6:31284340-31284362 CAGTGTCCAGAAAAGAAGATGGG + Intronic
1006196727 6:32247564-32247586 CTGCTTCCAGAAGAGCAGAGTGG - Intergenic
1007325526 6:41056579-41056601 CTGCATCCAAAAAACCAGAGAGG + Intronic
1009270379 6:61606329-61606351 CAGCTTCCAGAAGAGCAGAGTGG + Intergenic
1012864324 6:104599420-104599442 CTGTTTCAAGAAAGGCAGTGAGG + Intergenic
1016052071 6:139540070-139540092 CTGTTTACAGAAAGGAAGAGCGG - Intergenic
1017255582 6:152329675-152329697 CTGTTTACAAATAAGCAGAGTGG + Intronic
1018270005 6:162066891-162066913 CTGTTACCATAAAAGAAGAGAGG - Intronic
1018384536 6:163290935-163290957 CTTTGACCAGGAAAGCAGAGGGG - Intronic
1018990019 6:168667457-168667479 ATGCATTCAGAAAAGCAGAAAGG - Exonic
1021246663 7:18271519-18271541 CTGGATCAAGAAAAGCAAGGGGG - Intronic
1021262243 7:18472527-18472549 CTGTATCACAAAAAGCAGTGGGG - Intronic
1021528620 7:21617978-21618000 CTGTCCCCAGGACAGCAGAGCGG + Intronic
1021543235 7:21783764-21783786 CTGGATCCACAAGAGGAGAGTGG + Intronic
1021544218 7:21795098-21795120 ATGTCACCAGAAAGGCAGAGTGG - Intronic
1022488892 7:30801444-30801466 CTGTATCCACCACAGAAGAGAGG - Intronic
1022736509 7:33081209-33081231 CTGTTTCCAGAAGAGCAGAGTGG - Intergenic
1023153297 7:37222499-37222521 CTGTGGCCAGGATAGCAGAGAGG + Intronic
1023639275 7:42241369-42241391 CAGGACCCAGGAAAGCAGAGTGG - Intergenic
1024184272 7:46933112-46933134 CTGAATCCAGAGTAGAAGAGAGG + Intergenic
1025090798 7:56062452-56062474 ATGTATCCAGAAGAAGAGAGGGG + Intronic
1026183209 7:68060525-68060547 CTTTCTCCAGAAAAAGAGAGAGG + Intergenic
1026333549 7:69374165-69374187 CTGTATCCAAAACATCGGAGCGG + Intergenic
1027427701 7:78078260-78078282 GTGTATCCAAAACAGCTGAGTGG - Intronic
1027773876 7:82442576-82442598 CTATTTCCAGAACAGCAGCGAGG + Intronic
1028134108 7:87208471-87208493 TTGTACCCTGAAAAGCACAGGGG - Intronic
1029601748 7:101568461-101568483 CTTTATCCAGACAGCCAGAGTGG - Intergenic
1030563309 7:111119110-111119132 CTTTCTCCAGCAGAGCAGAGAGG - Intronic
1030784228 7:113640621-113640643 CTGTATCCAGAAAAGCCACAGGG - Intergenic
1031424934 7:121594135-121594157 CTATAAACAGAAAAGAAGAGTGG + Intergenic
1032155442 7:129463884-129463906 CAGCATCCAGAAAAGCAAACAGG - Intronic
1032986931 7:137347371-137347393 CTCTATTCAGCATAGCAGAGAGG - Intergenic
1035534024 8:377602-377624 CTTTATACACAAAAGCAGACGGG - Intergenic
1035571088 8:673031-673053 GCGTATCCAGAGAAGCAGTGTGG - Intronic
1037378699 8:18261357-18261379 CAGCTTCCAGAAGAGCAGAGAGG - Intergenic
1038648493 8:29381176-29381198 CAGCTTCCAGAAAAGCAGAGTGG + Intergenic
1039648560 8:39314841-39314863 CTGTGGCCAAAAAGGCAGAGAGG + Intergenic
1040416196 8:47198101-47198123 TTGGATCCAGAGAAGCAGATGGG + Intergenic
1040628261 8:49177078-49177100 CTCTATTCTGAAAAGCAGAGGGG + Intergenic
1043667040 8:82827247-82827269 CTGTATAGAAAAAAGCATAGTGG - Intergenic
1044298234 8:90553405-90553427 CTGTATCCAAAAAAAAAAAGAGG - Intergenic
1044510032 8:93065547-93065569 CTGAATTCATAAAAGCAGAGAGG + Intergenic
1045424511 8:102051182-102051204 CTGGCTCCAGAAAATCAGTGAGG - Intronic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1046089425 8:109481874-109481896 CTGTATGAAGAAAACCAGATTGG - Intronic
1046281264 8:112035404-112035426 TTGAATTCATAAAAGCAGAGAGG + Intergenic
1048342707 8:133553171-133553193 CTGTTAACAGCAAAGCAGAGTGG - Intronic
1049865105 8:144930157-144930179 CTGTATAAAGAAAAGTAGGGTGG + Intergenic
1050021513 9:1289300-1289322 CTTTATCCATGAAAGCAAAGAGG - Intergenic
1050279323 9:4033907-4033929 CTGAACCCAGAAATGCAGATAGG - Intronic
1051830298 9:21268411-21268433 TGGGATCCAGAAAAGCAGAGAGG + Intergenic
1053337340 9:37287032-37287054 CTGTTTCAACAACAGCAGAGAGG - Intronic
1055057926 9:72040473-72040495 TTTTATACAGAAAGGCAGAGGGG - Intergenic
1055750700 9:79501769-79501791 TTCTTGCCAGAAAAGCAGAGTGG + Intergenic
1058082174 9:100712160-100712182 CTGTACCCTGCAAAGCACAGGGG - Intergenic
1058833793 9:108842763-108842785 CTGTAACAAGAAGAGCAGAGGGG + Intergenic
1060861520 9:126958599-126958621 CACTATCCAGCAAAACAGAGAGG - Intronic
1061046193 9:128166394-128166416 CTGTATCCAGAAATACAAGGCGG - Exonic
1061479064 9:130887557-130887579 CTGGACCCCGAGAAGCAGAGGGG - Intronic
1061652948 9:132065854-132065876 GAATGTCCAGAAAAGCAGAGAGG - Intronic
1061868656 9:133508307-133508329 CTGAAGCTAGAAAAGCAAAGTGG - Intergenic
1187467133 X:19537602-19537624 ATGTATCCAGATCTGCAGAGAGG + Intronic
1187647662 X:21366637-21366659 CTGTATCCAGAAAGAGAGAGAGG - Intergenic
1188059480 X:25583378-25583400 ATGAAGCCAGAAAAGAAGAGAGG + Intergenic
1190085420 X:47391547-47391569 CTTTTTCCAGAAGAGGAGAGGGG - Intronic
1190085539 X:47392379-47392401 CTTTTTCCAGAAGAGGAGAGGGG - Intronic
1193241513 X:79175741-79175763 CTGTTTTGAGAAGAGCAGAGGGG - Intergenic
1193603684 X:83540212-83540234 CTGTATCCAGAAAAGGGGTGTGG + Intergenic
1194098217 X:89670098-89670120 CAGTATTCTGAAAAACAGAGAGG - Intergenic
1194731595 X:97461786-97461808 CTATATACAGAAAAGCCTAGAGG - Intronic
1195387774 X:104329390-104329412 CTGTTTCCAGTAAATCAGACAGG + Intergenic
1195459470 X:105107894-105107916 CTGTATCAAGGAAGACAGAGTGG - Intronic
1197849216 X:130839186-130839208 CTGCCTCCAGAAAATCAGAAAGG - Intronic
1199567545 X:149231048-149231070 TTGTTTGCAGAACAGCAGAGGGG - Intergenic
1199932314 X:152536039-152536061 CTGTATCGAATAAAGCAGATAGG + Intergenic
1200451234 Y:3331486-3331508 CAGTATTCTGAAAAACAGAGAGG - Intergenic
1201269866 Y:12244221-12244243 CTGAACCCAGAAAATCTGAGAGG - Intergenic
1202043040 Y:20706026-20706048 CTCTATTCTGAAAAACAGAGAGG + Intergenic