ID: 1045455379

View in Genome Browser
Species Human (GRCh38)
Location 8:102373477-102373499
Sequence ACAGGTATTCAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045455379 Original CRISPR ACAGGTATTCAGAATGTGGA TGG (reversed) Intronic
903360459 1:22773739-22773761 ACAGGGCGCCAGAATGTGGAGGG - Intronic
904132159 1:28282987-28283009 GCAGGTAATCATAATGTGGTGGG - Intergenic
904903120 1:33873263-33873285 ACATGTATTCTGCATGTGGAAGG + Intronic
906690294 1:47788140-47788162 AGAGGAATTGAGGATGTGGAAGG + Intronic
906834007 1:49063345-49063367 ACAGGTAAATAGAATTTGGATGG + Intronic
908331481 1:63074977-63074999 ACGGGTATTGAGGATGGGGAGGG - Intergenic
909160640 1:72144956-72144978 TAAGGTATCCAGAATATGGAAGG - Intronic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
910150955 1:84144410-84144432 ACAGCTCTTCAGAAATTGGAAGG + Exonic
912082582 1:105955354-105955376 ACATTTATTTAAAATGTGGAAGG + Intergenic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912704634 1:111902865-111902887 ACAAGTGTTCAGAATGGGCAGGG - Intronic
915318288 1:155041989-155042011 AGAGCTATTCAGCAGGTGGAGGG - Intronic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917443419 1:175086472-175086494 ACAGGTTTCCAGCATGGGGAAGG - Intronic
918720190 1:187842551-187842573 ACAGGTAGAAAGAATGTGGAGGG + Intergenic
918739427 1:188108299-188108321 AAAGGTAGTCAGAATGTAGGAGG - Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919430293 1:197484105-197484127 ACAGGTATTAAGATTATGCATGG - Intergenic
919842374 1:201618856-201618878 ACAGGTATTCAGCATCTTTAAGG - Intergenic
921211666 1:212905832-212905854 ACAAGAATACACAATGTGGAAGG + Intergenic
921218047 1:212953311-212953333 AGAGGTCTTCAGAAAGAGGAGGG - Intronic
921392205 1:214627675-214627697 ACAAGTATTAAGAACCTGGAGGG - Intronic
921678919 1:218008468-218008490 ACAGGTGGTGAGAATGTGGGGGG + Intergenic
921769165 1:219014595-219014617 ACAGGGATTCAAAATTTGGCAGG + Intergenic
922092980 1:222415145-222415167 ACAGGCTTTCAGAATATGCATGG - Intergenic
923518664 1:234719402-234719424 GCAAGTTTTGAGAATGTGGAGGG + Intergenic
923888942 1:238189685-238189707 ACAGGTTGGCACAATGTGGATGG - Intergenic
1065838372 10:29679724-29679746 AAAGGTATTTAGAAAGTGGCTGG - Intronic
1070316022 10:75313229-75313251 AAAGGTATTCTCATTGTGGATGG - Intergenic
1072349015 10:94539809-94539831 AAAGGTATTCAGGATGCAGATGG + Intronic
1073937329 10:108648988-108649010 ACAGGGAGTGAGAAAGTGGATGG - Intergenic
1074048616 10:109862262-109862284 ACAGGTCTGCAGTATTTGGAGGG - Intergenic
1074197635 10:111203281-111203303 GCAGGTGTTCAGAGTGGGGAGGG + Intergenic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075177132 10:120175727-120175749 ACATGTATACCTAATGTGGAGGG - Intergenic
1075216482 10:120540637-120540659 ATAGTTATTCAGGATGTGCAGGG - Intronic
1076426061 10:130368433-130368455 ACAGGGATTCAGAAGAAGGAGGG + Intergenic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1078918280 11:15801511-15801533 ACAGATATTCAGAGTGTTTAGGG + Intergenic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1079812530 11:25013196-25013218 ACAGATAAACAGAATGTGAAGGG + Intronic
1079814455 11:25038619-25038641 ACTGGAATTCAGAATCTGGATGG - Intronic
1081990843 11:47336765-47336787 ACAGGTGTTGAGACTGTGGCAGG - Intronic
1082809648 11:57471663-57471685 ACAGCTTTTCAGAATGGGGAAGG + Intronic
1082877608 11:58003854-58003876 CCATGTATTCAGAATGTAGCTGG - Intergenic
1085220201 11:74867248-74867270 AATGGAATTCAGAATATGGATGG + Intronic
1086240775 11:84687628-84687650 CCAGGTATTCAAAATGTACAAGG + Intronic
1086952776 11:92908094-92908116 ACAGGTATACAGGATGGAGAGGG + Intergenic
1088115888 11:106312635-106312657 ACCGGTATCCAGAATATGTAAGG - Intergenic
1089008094 11:115109630-115109652 ACAGGAAGTCAGAAAGTGCAAGG + Intergenic
1090297595 11:125602857-125602879 ACAGACATTCCGAATGTCGATGG - Exonic
1090567170 11:128007069-128007091 ACAGGTGGTCTGAATGAGGAAGG + Intergenic
1091115716 11:133011309-133011331 ACAGTTATTCAGAATAGTGAGGG + Intronic
1091257411 11:134201808-134201830 ACAGGTTTTCTAAATGTGGTAGG - Intronic
1092507577 12:9119752-9119774 AGATGTATTAAGAATGTGGGTGG + Intergenic
1092576914 12:9794848-9794870 ACAGGTCGTAAGAATATGGAAGG - Intergenic
1092657045 12:10696804-10696826 CCAGGCTTTCAGAATGGGGATGG - Intergenic
1096901909 12:54892023-54892045 AAAGGTAGTCAGAATATGGGAGG - Intergenic
1097100116 12:56581863-56581885 ACAGCTCTTCAGAATGGGTAAGG + Exonic
1097178916 12:57159821-57159843 ACAGGCATCCACAATGTGGAGGG + Exonic
1097790094 12:63806442-63806464 ACAGGCCTTAAGAATGTGCATGG + Intronic
1098614461 12:72506194-72506216 CCAGCTATTCAGAAAGTTGATGG + Intronic
1101295101 12:103414364-103414386 ACTGGTATCCAGAATCTGCAAGG - Intronic
1102710770 12:114924614-114924636 GCAGGATTTCAGAAAGTGGATGG + Intergenic
1102757597 12:115355643-115355665 ATAGGAATTCAGAGTCTGGAAGG + Intergenic
1102966148 12:117128050-117128072 ACAGGTAACCATAATGTGAATGG - Intergenic
1104509973 12:129368359-129368381 ACAAGGATGGAGAATGTGGAAGG - Intronic
1105313626 13:19236276-19236298 GCAGGCATTGAGAGTGTGGATGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108275554 13:48805926-48805948 ACAAGTTTTTAGAATGAGGAAGG + Intergenic
1109201707 13:59438583-59438605 AATGGTAGTCAAAATGTGGAAGG - Intergenic
1109277631 13:60320272-60320294 ACAGGTATATAGAATCTGGGAGG + Intergenic
1110239840 13:73254836-73254858 ACAGGGATTCACCATGTTGATGG + Intergenic
1111445027 13:88335943-88335965 TCATGTGTTCAGCATGTGGAGGG + Intergenic
1112915483 13:104544908-104544930 ACATGTATTCACAATGTTTAAGG - Intergenic
1113633792 13:111906172-111906194 AAAGGTTTTTAGAATGTGGACGG - Intergenic
1113634995 13:111913338-111913360 AGAGGTATTCAGGAGGTGGGGGG + Intergenic
1116021498 14:39468039-39468061 ACAGGTATTCAGAATGACTTGGG + Intergenic
1116666399 14:47781300-47781322 ACTGGTATTCAAAGTGAGGATGG - Intergenic
1117295127 14:54372104-54372126 GAAGGTATTCAGAAAGTGGTGGG + Intergenic
1117747918 14:58890461-58890483 ACATGTGTTCCCAATGTGGAAGG + Intergenic
1118233062 14:63972219-63972241 ACAGGTCCTCACAAAGTGGAAGG + Intronic
1118442502 14:65824630-65824652 ACAGGTATTCAGTGTGGAGAAGG + Intergenic
1118629458 14:67689471-67689493 ACAGGTACTGGGAATATGGAGGG - Intronic
1121240996 14:92430135-92430157 AAAGTTACTCAGAAGGTGGAAGG - Intronic
1121447113 14:93986054-93986076 AGAGGCACTCAGAGTGTGGAAGG - Intergenic
1121963934 14:98287253-98287275 ACAGATATTCAGTGTGTGTAAGG + Intergenic
1123461319 15:20474550-20474572 ACATGTAATAAGAATGTGGCTGG - Intergenic
1123656740 15:22525830-22525852 ACATGTAATAAGAATGTGGCTGG + Intergenic
1124310652 15:28621007-28621029 ACATGTAATAAGAATGTGGCTGG + Intergenic
1126074866 15:44899367-44899389 ACAAGTATTCAGAATGATCATGG - Intergenic
1126083498 15:44988448-44988470 ACAAGTATTCAGAATGATCATGG + Intergenic
1126484871 15:49169111-49169133 ACATGTATACAGAAGGGGGAAGG + Intronic
1127277676 15:57461536-57461558 ACAGGTGTGCGGGATGTGGAAGG + Intronic
1128880308 15:71236408-71236430 ACAGGTCCTCAGAATGGAGAGGG - Intronic
1129616769 15:77105010-77105032 TCAGGTAAAGAGAATGTGGAGGG - Exonic
1130174909 15:81558650-81558672 ACATGTATTCAGAATCTGGATGG - Intergenic
1132138179 15:99365057-99365079 ACAGGTATTCAGAATTTGATTGG - Intronic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138162752 16:54771283-54771305 TCAGGGATTCAGAATGAAGATGG + Intergenic
1138235772 16:55381205-55381227 AAAGTTATTCAGAAAGTGGATGG + Intergenic
1138653408 16:58474795-58474817 ACATGTACTGAGAATGGGGAAGG + Intronic
1140074719 16:71687289-71687311 ACTTGTATTCAGAATATGTAAGG - Intronic
1146381818 17:32335891-32335913 ATTCGTATTCAGAATGTGAATGG + Intronic
1146581805 17:34045110-34045132 ACAGGTTCTCAGGATCTGGAAGG - Intronic
1147116784 17:38306430-38306452 ACAGTTATTGAGTAAGTGGATGG + Intronic
1149716730 17:58798149-58798171 ACTGATATTCAGAATGTGTTAGG - Intronic
1150222662 17:63506039-63506061 ACAGGGATTCTGAGTGTGGAGGG + Intronic
1151072693 17:71234151-71234173 ACAGGTATTCTGCTTCTGGAAGG + Intergenic
1156832156 18:41504650-41504672 TCATGTAATCAGCATGTGGATGG - Intergenic
1157000351 18:43515315-43515337 AACGGAATTCAGAATGTAGATGG - Intergenic
1157095398 18:44681661-44681683 AGAGGTATTGAGAGTGTGGAAGG + Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1159318604 18:66814861-66814883 ACAGGTATTCAAGATGAAGAGGG + Intergenic
1159518394 18:69487751-69487773 AGAGATCTTCAAAATGTGGAGGG - Intronic
1159883810 18:73885210-73885232 AAAATTATTCAGAATGTGGCTGG + Intergenic
1166388273 19:42394418-42394440 ACAGGTGGTCAGAATTTGGTGGG - Intergenic
925496626 2:4457492-4457514 ATAGGAACTCAGGATGTGGAAGG - Intergenic
926269255 2:11352823-11352845 ACAGGTGGTCAGAAAGAGGATGG + Intergenic
926431877 2:12795404-12795426 AGAGGGATTCAGAATGTTAAAGG + Intergenic
928350575 2:30549478-30549500 AAAGAAATTCAGAATTTGGAGGG + Intronic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929327930 2:40640387-40640409 CCAGTTATTCTGAATTTGGAAGG + Intergenic
930986806 2:57598924-57598946 ACAGGTATGGAGAAGGTGAAAGG + Intergenic
932781719 2:74562712-74562734 ACATGTATGCTGAATGTGGTAGG - Intronic
933449739 2:82432615-82432637 ACAGGAATATAGAATGGGGAAGG - Intergenic
933551277 2:83779832-83779854 ATAGGTATTCAGAATTTGGAAGG - Intergenic
933562620 2:83907371-83907393 ACAAATATTCAGAATGTACAGGG - Intergenic
936959775 2:118061010-118061032 ACTGGTATTCAGCAGGTGGATGG + Intergenic
941432921 2:165433697-165433719 ACATGGCTTCAGAATGAGGAAGG - Intergenic
943292985 2:186099389-186099411 ACAGATATTGAGATAGTGGAAGG - Intergenic
945758800 2:213884953-213884975 CAAGGAATTCAGAATCTGGATGG - Intronic
946279769 2:218658624-218658646 ACAGGGATTCACAAGGTGGCTGG + Intronic
1170033975 20:11970670-11970692 ACATGAATGGAGAATGTGGATGG - Intergenic
1170802703 20:19603534-19603556 ACAGGTGTTCAGACTCAGGAGGG - Intronic
1172598016 20:36163826-36163848 GCAGGAATTCAGAAGGTGGAAGG - Intronic
1174528088 20:51189607-51189629 ACAGGTATTAATGATGTGGAAGG + Intergenic
1175270780 20:57732426-57732448 AGAGATATTCAGCATGTGGATGG - Intergenic
1176277491 20:64280665-64280687 ACATGTGTCCAGAATGTGGTTGG + Intronic
1177362099 21:20085962-20085984 GCAAGTATTTAAAATGTGGAGGG + Intergenic
1177397095 21:20550601-20550623 ACAAGTATTGAGATTCTGGAAGG + Intergenic
1177599475 21:23291371-23291393 CCAGGTGTTCAGAGTGAGGAAGG + Intergenic
1178246831 21:30961074-30961096 ATAGGTATGCATAATGGGGATGG - Intergenic
1179355073 21:40651477-40651499 GCAGGTATTCAGAATATATACGG - Intronic
1179958388 21:44753964-44753986 AAAGGTCTTCAGCATGAGGAGGG - Intergenic
1181149778 22:20874986-20875008 AGAGGTATGTAGGATGTGGAAGG - Intronic
1181411877 22:22729551-22729573 ACAAGTTTTCAGAGTGTAGAGGG - Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1185151780 22:49167883-49167905 GAAGATATTCAGAATGTGTAGGG - Intergenic
953080636 3:39614031-39614053 ACAAGTATTCAGAATCTATAAGG + Intergenic
953872958 3:46643509-46643531 ACATGTATTCTGAATGTGAGAGG - Intergenic
953991876 3:47490118-47490140 ACTTGTATCCAGAATATGGAAGG - Intergenic
956555207 3:70513879-70513901 CCAGGTGTTCAGAATGGGAATGG - Intergenic
957750487 3:84408589-84408611 ACAGGTGGTGAGAATGTGGGGGG - Intergenic
958700111 3:97578282-97578304 ACAGCTGTTCAGTATGTCGAAGG - Intronic
960265712 3:115618725-115618747 ACAGGGACACAGAATGGGGAAGG + Intergenic
961598977 3:128043981-128044003 ACACGGATTGAGAATGTGGGAGG - Intergenic
962827484 3:139110572-139110594 ACAGGTATGAAGAATGGGCAGGG + Intronic
963656225 3:148054834-148054856 ACATGTATTTAGTATGTGCATGG + Intergenic
964308425 3:155365090-155365112 ACAGGTAATCAGAAGGTTGATGG + Intergenic
965674311 3:171178981-171179003 AGAGGTCTGCACAATGTGGAGGG + Intronic
967006952 3:185393149-185393171 AGAGATATTCAGAATGTTAAAGG + Intronic
968658841 4:1790512-1790534 GAAGCCATTCAGAATGTGGAGGG + Intergenic
969582922 4:8076317-8076339 AAAAGCATTCAGAATGCGGAGGG - Intronic
970128231 4:12838436-12838458 ACAGGTTCACAGATTGTGGAAGG + Intergenic
970522473 4:16899430-16899452 ACAGTCGTTCTGAATGTGGAAGG + Intergenic
970831022 4:20339995-20340017 AAAGGTATTCAGATTATAGATGG - Intronic
971878011 4:32329082-32329104 ACAGGTATTCTGAATCTGGCAGG - Intergenic
973266258 4:48214263-48214285 ACAGGAATTCAGAAAGGGCAAGG + Intronic
975558189 4:75684764-75684786 ACATGTATACAGAATGTTCATGG - Intronic
975904192 4:79189711-79189733 ACAAGTATTCAGATAGGGGATGG - Intergenic
977178200 4:93840418-93840440 ACAGGTAGTGAGAAAGTGCAAGG - Intergenic
979657264 4:123209756-123209778 ACAGGAACTTAGAAGGTGGAAGG + Intronic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980341129 4:131548824-131548846 ACAGGTAATCAGAATGAGTCAGG - Intergenic
981081474 4:140642976-140642998 ACTGGACTTCAGAATGTGGCGGG - Intronic
982500354 4:156146954-156146976 ACCGGTATTGAGACTGTTGAAGG + Intergenic
983012954 4:162572011-162572033 AGAGGACTTCAGCATGTGGAAGG - Intergenic
984294134 4:177832107-177832129 ACAGGTCCACAGAAGGTGGACGG - Intronic
985278719 4:188266285-188266307 AAAGGAATCAAGAATGTGGAAGG - Intergenic
986556527 5:9015346-9015368 ACAGGTGTTCAGACTGTGATAGG + Intergenic
986985183 5:13493235-13493257 ACAAGAATTCAGAACCTGGATGG - Intergenic
987194663 5:15514388-15514410 ACAGGTATTCCTAATGGGGGAGG - Intronic
989418989 5:41213432-41213454 ATAGGTATGCAGAATGAAGAGGG + Intronic
990879492 5:60523455-60523477 ACAGGTAGTTGGAATGTGGAGGG - Intergenic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
992557577 5:77918064-77918086 ACAGGTTTTCAGAATGAAGTTGG + Intergenic
992590257 5:78288017-78288039 AAAGGAATTCACAATGAGGAAGG + Intronic
993513928 5:88805894-88805916 ACAGGTATTCATTCTGTAGATGG - Intronic
993595852 5:89854179-89854201 ACATTCCTTCAGAATGTGGAAGG - Intergenic
995012479 5:107273242-107273264 TCAGATATTCAGAATGTGGTTGG + Intergenic
995394063 5:111668810-111668832 AAAGATATTCAGAATGTATAGGG - Intronic
996553077 5:124749793-124749815 ACACGTATTTAAACTGTGGAAGG + Intergenic
997035801 5:130189949-130189971 ACAGCTAATAAGAATATGGATGG - Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
998803027 5:145890202-145890224 CCAGGTATTCAGGAGGTTGAGGG - Intergenic
1001015890 5:168140699-168140721 ACAGGTATCCAGAATCCTGAAGG - Intronic
1001723934 5:173880747-173880769 ACAGGCATTCAGAAGCTAGAGGG - Intergenic
1002652911 5:180716111-180716133 TCTGGTATTCAGAATCTGTAAGG + Intergenic
1002811633 6:636756-636778 AGATGCATTCAGAATGAGGAAGG - Intronic
1003025787 6:2554634-2554656 GCTGTTATTCAGAATGTGGTTGG + Intergenic
1003653223 6:7981301-7981323 ACCAGTATCAAGAATGTGGAAGG - Intronic
1004890314 6:20095021-20095043 CCAGGACTTCAGAATGTGAATGG + Intergenic
1007705911 6:43791289-43791311 ACTGGTATTCATGAAGTGGATGG + Intergenic
1009334770 6:62473401-62473423 ACAGTTCTTCAGCATGTTGAGGG + Intergenic
1010032501 6:71286257-71286279 AAAGGTATTCAGATGGTGGATGG + Intergenic
1011380669 6:86739204-86739226 ATATGTATTCAGAATTTAGATGG + Intergenic
1014661235 6:124175004-124175026 ACAGGTATTCACAAAGTAAAAGG - Intronic
1015160289 6:130145321-130145343 ACAGGTATGTAGTATGTGAATGG - Exonic
1016095574 6:140032469-140032491 ACAGGACTTCATACTGTGGAGGG - Intergenic
1016985275 6:149890273-149890295 ACAGGGATCCAGAAGGTTGAGGG - Intronic
1017122416 6:151037143-151037165 ACAGCAATGCAGAATGGGGAGGG - Intronic
1017270264 6:152495618-152495640 ACAGGTAATCAGAATGAGTCAGG - Intronic
1017809778 6:157976618-157976640 ACAGGGCTTCTGCATGTGGAAGG - Intergenic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1020119435 7:5494940-5494962 ACAGGTGTTCAGGATGTGGCAGG + Intronic
1020331922 7:7027371-7027393 ACTAGTATTCAGAATCTGTAAGG - Intergenic
1020655966 7:10928390-10928412 GCAGGTAATCAGAATGAGGGTGG - Intergenic
1021363055 7:19740772-19740794 AAATGAATTCAGAATCTGGAGGG + Intronic
1022240582 7:28508467-28508489 ACAGAAATTCAAAATGTGAAAGG + Intronic
1022731884 7:33034283-33034305 ACAGTTATTCAGACTGTTGAAGG - Intronic
1023199075 7:37674212-37674234 ACAGGTTATCAGAATGAAGATGG + Intergenic
1023351011 7:39320231-39320253 ACGGAGATTCAGAATCTGGAAGG - Intronic
1026230404 7:68478278-68478300 ACAGGTATCCAAAGTGTTGAAGG - Intergenic
1027461978 7:78465811-78465833 AGAGGTATTCTGAAAGAGGAAGG - Intronic
1028231537 7:88311518-88311540 ACATGTGGTCAGAATGAGGAAGG + Intergenic
1028495670 7:91457009-91457031 ATAAGTATTTAGAATTTGGAGGG + Intergenic
1029551899 7:101240980-101241002 AGAGGCATTCAGAGAGTGGAAGG - Intronic
1032894004 7:136230906-136230928 AAAGGTATGCAGAATTGGGAAGG - Intergenic
1033552400 7:142459437-142459459 AGAGTTATTCAGAATGAGGGTGG + Intergenic
1033559285 7:142515940-142515962 AGAGTTATTCAGAATGAGGGTGG + Intergenic
1033772579 7:144568846-144568868 ACAGGTATGCTGTATGAGGAAGG + Intronic
1037324314 8:17673381-17673403 CTAGGTATTAAGAATCTGGACGG + Intronic
1037467995 8:19178769-19178791 ACAGATATTTAAAATGTGGCTGG + Intergenic
1039706511 8:40012903-40012925 ACAGGTATTGATAATAAGGATGG - Intronic
1041354430 8:56985354-56985376 ACAGGTAGTAAGGATGAGGAAGG - Intronic
1041686020 8:60645260-60645282 GCAGGTTTCCAGAAAGTGGAAGG - Intergenic
1043738485 8:83776269-83776291 AAAAGAATTCAGAATATGGATGG + Intergenic
1044243819 8:89917831-89917853 ACAGGGATCCAGAATGTGGCTGG - Intronic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1045618455 8:103946006-103946028 AAAGGCATTCAGAATGGTGAGGG + Intronic
1045807469 8:106181382-106181404 ACAGGAATTCAGAATGGGAAGGG - Intergenic
1047825606 8:128571069-128571091 ACAGGTAATTAGAATGTGAATGG - Intergenic
1048182547 8:132209265-132209287 ACAGGTTTAGAGAATGAGGAGGG - Intronic
1048457062 8:134587775-134587797 GAAGGAATTCAGAAGGTGGAAGG - Intronic
1048837102 8:138530293-138530315 ACATGTATTAAGAAGGTGGTGGG - Intergenic
1050516411 9:6448754-6448776 ACAGGAGTTAAGAATGTGGTAGG + Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1051552118 9:18341473-18341495 ACATTTATTCTGGATGTGGAAGG - Intergenic
1054904551 9:70403282-70403304 ACATATATCCAGAATGGGGAAGG - Intronic
1055619022 9:78104309-78104331 ACAATTATTGAGAATGAGGAAGG + Intergenic
1187940704 X:24378093-24378115 ACAGGTTCTCAAAATGTGGATGG - Intergenic
1188867164 X:35327398-35327420 ACAGGTAATTAGATTGGGGAAGG + Intergenic
1191036827 X:56033881-56033903 AAAGGTATTCAAAATATGTAAGG - Intergenic
1191137200 X:57077980-57078002 ACTGGTATTCAGAATCTACACGG - Intergenic
1194213163 X:91093888-91093910 AGAGATATTCAGGACGTGGAGGG - Intergenic
1194264749 X:91740701-91740723 ACAGGTAGTTAAAAAGTGGAGGG - Intergenic
1196049536 X:111290325-111290347 ACAGGTGGAGAGAATGTGGAAGG + Intergenic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197788554 X:130225708-130225730 ACAGGTAATCTGAATGTGTTTGG + Intronic
1200763034 Y:7057172-7057194 GCAGGTAATCAGAATGAGGGTGG + Intronic
1201362531 Y:13168511-13168533 ACAGGTAATCAGAATGAGTCAGG - Intergenic
1201678994 Y:16621361-16621383 ACAGTTATTTACACTGTGGATGG - Intergenic