ID: 1045458057

View in Genome Browser
Species Human (GRCh38)
Location 8:102401450-102401472
Sequence GTACTGACTCCTGTCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045458056_1045458057 -7 Left 1045458056 8:102401434-102401456 CCTGTACTGTACTACAGTACTGA No data
Right 1045458057 8:102401450-102401472 GTACTGACTCCTGTCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045458057 Original CRISPR GTACTGACTCCTGTCTCTGC AGG Intronic