ID: 1045464339

View in Genome Browser
Species Human (GRCh38)
Location 8:102455718-102455740
Sequence CTGTGTGATTGGAGAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045464335_1045464339 -1 Left 1045464335 8:102455696-102455718 CCATTACCAAGCCAAACAATATC No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data
1045464331_1045464339 28 Left 1045464331 8:102455667-102455689 CCCGGCCACATCTTATAAGATGT No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data
1045464332_1045464339 27 Left 1045464332 8:102455668-102455690 CCGGCCACATCTTATAAGATGTC No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data
1045464336_1045464339 -7 Left 1045464336 8:102455702-102455724 CCAAGCCAAACAATATCTGTGTG No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data
1045464334_1045464339 0 Left 1045464334 8:102455695-102455717 CCCATTACCAAGCCAAACAATAT No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data
1045464333_1045464339 23 Left 1045464333 8:102455672-102455694 CCACATCTTATAAGATGTCTTAT No data
Right 1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045464339 Original CRISPR CTGTGTGATTGGAGAGATGT TGG Intergenic
No off target data available for this crispr