ID: 1045465644

View in Genome Browser
Species Human (GRCh38)
Location 8:102467358-102467380
Sequence TGCACTTCTCCCGAGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045465644_1045465648 3 Left 1045465644 8:102467358-102467380 CCCACCTGCTCGGGAGAAGTGCA No data
Right 1045465648 8:102467384-102467406 AAGTGGCATGCCATAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045465644 Original CRISPR TGCACTTCTCCCGAGCAGGT GGG (reversed) Intergenic
No off target data available for this crispr