ID: 1045467592

View in Genome Browser
Species Human (GRCh38)
Location 8:102484754-102484776
Sequence GAACACATCTGAACATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045467592_1045467601 15 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467601 8:102484792-102484814 TGGTGGGTTCTTGGTCTGGCTGG No data
1045467592_1045467596 -2 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467596 8:102484775-102484797 TCGGAGTTTCTTCCTTCTGGTGG No data
1045467592_1045467600 11 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467600 8:102484788-102484810 CTTCTGGTGGGTTCTTGGTCTGG No data
1045467592_1045467598 6 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467598 8:102484783-102484805 TCTTCCTTCTGGTGGGTTCTTGG No data
1045467592_1045467597 -1 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467597 8:102484776-102484798 CGGAGTTTCTTCCTTCTGGTGGG No data
1045467592_1045467602 21 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG No data
1045467592_1045467595 -5 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467595 8:102484772-102484794 TGTTCGGAGTTTCTTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045467592 Original CRISPR GAACACATCTGAACATCAGG AGG (reversed) Intergenic