ID: 1045467602

View in Genome Browser
Species Human (GRCh38)
Location 8:102484798-102484820
Sequence GTTCTTGGTCTGGCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045467592_1045467602 21 Left 1045467592 8:102484754-102484776 CCTCCTGATGTTCAGATGTGTTC No data
Right 1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG No data
1045467594_1045467602 18 Left 1045467594 8:102484757-102484779 CCTGATGTTCAGATGTGTTCGGA No data
Right 1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045467602 Original CRISPR GTTCTTGGTCTGGCTGGCTC AGG Intergenic