ID: 1045468833

View in Genome Browser
Species Human (GRCh38)
Location 8:102493075-102493097
Sequence AATTATGGATAATTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045468833_1045468842 17 Left 1045468833 8:102493075-102493097 CCCTCCTCCAATTATCCATAATT No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data
1045468833_1045468838 5 Left 1045468833 8:102493075-102493097 CCCTCCTCCAATTATCCATAATT No data
Right 1045468838 8:102493103-102493125 ACCTTCACCCAAAATAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045468833 Original CRISPR AATTATGGATAATTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr