ID: 1045468842

View in Genome Browser
Species Human (GRCh38)
Location 8:102493115-102493137
Sequence AATAATCATGGTTAATATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045468834_1045468842 16 Left 1045468834 8:102493076-102493098 CCTCCTCCAATTATCCATAATTC No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data
1045468833_1045468842 17 Left 1045468833 8:102493075-102493097 CCCTCCTCCAATTATCCATAATT No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data
1045468837_1045468842 2 Left 1045468837 8:102493090-102493112 CCATAATTCTTCTACCTTCACCC No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data
1045468836_1045468842 10 Left 1045468836 8:102493082-102493104 CCAATTATCCATAATTCTTCTAC No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data
1045468835_1045468842 13 Left 1045468835 8:102493079-102493101 CCTCCAATTATCCATAATTCTTC No data
Right 1045468842 8:102493115-102493137 AATAATCATGGTTAATATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045468842 Original CRISPR AATAATCATGGTTAATATTT AGG Intergenic
No off target data available for this crispr