ID: 1045474087

View in Genome Browser
Species Human (GRCh38)
Location 8:102538381-102538403
Sequence CAGCATCACTTCACTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045474083_1045474087 11 Left 1045474083 8:102538347-102538369 CCTGGTTTGTAATGTTTGCTGAT 0: 2
1: 4
2: 23
3: 86
4: 470
Right 1045474087 8:102538381-102538403 CAGCATCACTTCACTGAACATGG 0: 1
1: 0
2: 5
3: 38
4: 189
1045474082_1045474087 12 Left 1045474082 8:102538346-102538368 CCCTGGTTTGTAATGTTTGCTGA 0: 2
1: 4
2: 24
3: 73
4: 383
Right 1045474087 8:102538381-102538403 CAGCATCACTTCACTGAACATGG 0: 1
1: 0
2: 5
3: 38
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045474087 Original CRISPR CAGCATCACTTCACTGAACA TGG Intronic
902245417 1:15117593-15117615 AAGCTTGACGTCACTGAACAGGG + Exonic
902376338 1:16031746-16031768 CAGCATCACCACACTGGCCAAGG + Exonic
902381301 1:16053675-16053697 CAGCATCACCACACTGGCCAAGG + Exonic
902896465 1:19483897-19483919 CAACATCCCTTGACTAAACAAGG + Intronic
903755828 1:25659941-25659963 CAACATGATGTCACTGAACATGG - Intronic
905236949 1:36556649-36556671 CAACATGACATCACTGAACTTGG + Intergenic
908129723 1:61063077-61063099 CAGCATTATTTTACTGAACAAGG + Intronic
913527046 1:119703560-119703582 CACCCTCACACCACTGAACATGG - Intronic
915034284 1:152909439-152909461 CCTCATCGCTTCACTGACCAAGG - Intronic
916011443 1:160709835-160709857 CAGCAGCACAACACTGCACATGG + Intronic
916685248 1:167138513-167138535 CTGCATCTCTGCACTGAATAGGG - Intergenic
917258476 1:173141590-173141612 CTGCACCACTTCATCGAACAGGG - Intergenic
917602454 1:176590317-176590339 CAGTATGATGTCACTGAACATGG - Intronic
918108576 1:181434929-181434951 CAACATGATTTCACTGAATAAGG - Intronic
918685154 1:187405629-187405651 CAGCACTACAGCACTGAACAGGG + Intergenic
919085898 1:192919678-192919700 CAACATCACTTTAGTGAACATGG - Intergenic
921443564 1:215218027-215218049 CATCATCTCTTCACTGTCCAGGG - Intronic
922853955 1:228758079-228758101 CAAAATCACTTCACAGAACATGG - Intergenic
923466897 1:234256569-234256591 CAGCATTCCTTCACTGACCACGG + Intronic
923707144 1:236353147-236353169 CAGCCTCACTTCACAGGCCAGGG + Intronic
1066322197 10:34314665-34314687 CAGCATGATGTCACTAAACACGG + Intronic
1066675574 10:37883689-37883711 TAGCATCACATCCCTGTACAGGG - Intergenic
1066699773 10:38114831-38114853 CAGCATCACATCCCTGTACAGGG - Exonic
1067136137 10:43608690-43608712 CAGCATCACATCCCTGTACAGGG - Exonic
1069563395 10:69447623-69447645 CAACTTCACTTCAATGAACTTGG - Intergenic
1070765779 10:79055404-79055426 CAGGATCACATCACTGCACTCGG + Intergenic
1070943982 10:80372964-80372986 CAGCAAAACGTCCCTGAACAGGG - Intergenic
1071806413 10:89125938-89125960 CGACATGACATCACTGAACATGG - Intergenic
1072382193 10:94885153-94885175 CAGCTTCACTTAACTGCATATGG - Intergenic
1073311645 10:102546966-102546988 CAGCACCACTTCACTAAGGAGGG - Intronic
1075211868 10:120498249-120498271 CAACATCATTTCACTTAATAGGG - Intronic
1075372221 10:121946813-121946835 CTGAATCACTTCTCTGCACATGG + Intergenic
1076415667 10:130286512-130286534 CAGCATCACATCTCTTTACAGGG + Intergenic
1077972872 11:7213650-7213672 CAACATGATGTCACTGAACATGG - Intergenic
1079312358 11:19378123-19378145 ACGCATCACTTCACTGCACATGG - Intronic
1083989597 11:66238862-66238884 CAGCCTCACTCCACAGAACAAGG - Intronic
1084231649 11:67757817-67757839 CACCATCACCTCTCTGCACAGGG - Intergenic
1087411276 11:97792848-97792870 CAGCATCACTACACTGTAGGAGG - Intergenic
1089708729 11:120299755-120299777 CAGCAGCACTTGACTGGACTTGG - Intronic
1090701098 11:129296384-129296406 CAGCATCACCTCTCTGTATAGGG + Intergenic
1090931041 11:131298227-131298249 CAGCATCTCTGCACTGCCCAAGG + Intergenic
1091648905 12:2294917-2294939 CAGCATTGCTTCACTGACCACGG - Intronic
1091720082 12:2806810-2806832 CTGCATCACTGCACTGAGCCTGG - Intergenic
1091802128 12:3330967-3330989 CAGCATCACCCCACTGAACGTGG - Intergenic
1094697605 12:32835997-32836019 CAACATGATGTCACTGAACATGG + Intronic
1095199266 12:39363669-39363691 CAGTATTATTTCTCTGAACAAGG + Intronic
1097524912 12:60720612-60720634 CAACATCACATGACTTAACATGG + Intergenic
1098051233 12:66455496-66455518 CAGCCTGAGTTCCCTGAACATGG - Exonic
1100235749 12:92659069-92659091 CAACATGACTTTACTGAACATGG + Intergenic
1100785481 12:98073652-98073674 CACCATCACTTCAAAGAACCTGG - Intergenic
1101310414 12:103573810-103573832 CAGAATCACTGCATGGAACAGGG - Intergenic
1101672762 12:106892086-106892108 CATCATGACATCACTGAACATGG - Intergenic
1102711286 12:114929840-114929862 CAGCATCATGTCTCTGTACAGGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107129251 13:36877912-36877934 GACCATCTCTTCACTGGACATGG + Intronic
1108918515 13:55647322-55647344 GAGCATCAGTTCATTGAATATGG + Intergenic
1112079343 13:95951721-95951743 CAGTCTCATTTCACTGAACATGG + Intronic
1113150924 13:107262808-107262830 CAACATCACTTCATTGTACATGG + Intronic
1113173136 13:107529320-107529342 CAGAATCACTTCACCGATCCAGG + Intronic
1113403501 13:110017544-110017566 CATCCTCACTTCCCTGAAGAAGG - Intergenic
1114530787 14:23394439-23394461 CAACATCACTACACTGAACATGG + Intronic
1116067266 14:40000698-40000720 CTGCATAACTACAGTGAACATGG + Intergenic
1116697900 14:48200567-48200589 CAACATCACCTCACTGAGCCTGG + Intergenic
1118537519 14:66784308-66784330 AAGAATAACTTCACTGAATATGG - Intronic
1120239463 14:81933272-81933294 CAGCCTCACTTCAGGAAACACGG - Intergenic
1120660607 14:87245636-87245658 CAGCTTTACTTCACTGGCCAGGG + Intergenic
1120872048 14:89346603-89346625 CAACATCACATCACTGAGGATGG + Intronic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1122341799 14:101033394-101033416 GAGCATCACTTCAGAGAAAATGG - Intergenic
1123478911 15:20613104-20613126 CAGCATCACATCGCGGTACAGGG + Intergenic
1123639101 15:22387281-22387303 CAGCATCACATCGCGGTACAGGG - Intergenic
1124951750 15:34329224-34329246 CATCATGACTTCACTGGAGAAGG - Intronic
1125327588 15:38552527-38552549 TAACATGACTTCACTGAACACGG + Intronic
1125588653 15:40840453-40840475 CAAGATCCCTTCAGTGAACATGG - Intergenic
1125827521 15:42689000-42689022 AAGAGTCAGTTCACTGAACAAGG + Exonic
1128687806 15:69699745-69699767 CAGCCTCCCCTCACTGACCAGGG + Intergenic
1135392661 16:22106740-22106762 CTGCATAACTTGACTGCACAGGG + Intronic
1138774519 16:59705428-59705450 CAACATCATGTCACTGAACATGG - Intergenic
1140047799 16:71454070-71454092 CAGCATCACATCCCTGTACAGGG + Exonic
1145990366 17:29075666-29075688 CAGGATCACAGCACTGAACAGGG + Exonic
1146862439 17:36315468-36315490 CAGAATCTCTGCATTGAACAAGG + Intronic
1147092767 17:38119566-38119588 CAGAATCTCTGCATTGAACAAGG + Intergenic
1147104441 17:38200924-38200946 CAGAATCTCTGCATTGAACAAGG - Intergenic
1148045360 17:44740542-44740564 CAAGAACACTTCACAGAACAGGG + Intronic
1148425051 17:47587503-47587525 CAGAATCTCTGCATTGAACAAGG + Intronic
1149388441 17:56165775-56165797 CAACATCACTTTCCAGAACAGGG + Intronic
1155334211 18:24748545-24748567 CAGCCTCAGTTCACTGGCCAGGG - Intergenic
1156619440 18:38831915-38831937 CAACATCCCTTCAGTCAACAGGG + Intergenic
1156640011 18:39082143-39082165 TAACATCACTGCACTGAAGAGGG + Intergenic
1156690073 18:39696875-39696897 CAGCATTAATTCACTGATAAGGG + Intergenic
1157815427 18:50726409-50726431 CACCATGACTCTACTGAACATGG + Intronic
1158838661 18:61359519-61359541 CACTCTCACTTCACTGAACAAGG + Intronic
1159001632 18:62980137-62980159 CACCCTCACTTCACTGAATGAGG + Exonic
1159136330 18:64341289-64341311 TAGTATCAATTCACTGTACATGG - Intergenic
1164083224 19:21878646-21878668 CACCATCACTTTAGTGAGCAGGG - Intergenic
1165636818 19:37347266-37347288 CAGCATCACCTCCCTGTGCAGGG - Exonic
1165655960 19:37532432-37532454 CAGCATCACATCCCGGTACAGGG - Exonic
1166022842 19:40048698-40048720 CAACATCACATCCCTGTACAAGG + Exonic
1166025765 19:40083139-40083161 CAACATCACATCCCTGTACAAGG + Exonic
1167977688 19:53243799-53243821 CAACATCACGTCCCTGTACAAGG + Exonic
1168581085 19:57556259-57556281 CAGCATCACCTCTCGGTACAGGG + Exonic
1168634900 19:57988623-57988645 CAGCATCACATCACGGTACAGGG + Exonic
1168646403 19:58061656-58061678 CAGCATTACATCACGGTACAGGG - Exonic
1168663619 19:58185788-58185810 CAGCATCACTTCCCTGTACAGGG - Intronic
928260936 2:29765878-29765900 CAACATGATATCACTGAACATGG + Intronic
936544888 2:113382812-113382834 CAACATCTCTTCACTCTACATGG + Intergenic
936654037 2:114463556-114463578 TAACATAACTTCACTGAAGAGGG - Intronic
936924664 2:117724147-117724169 CAGAATAAATTAACTGAACATGG + Intergenic
937835167 2:126464106-126464128 AAGCATTTCTTCACTGAAGAAGG - Intergenic
938489091 2:131749820-131749842 CAGCAGCAATACACTGAATATGG + Intronic
939425335 2:142028958-142028980 GAACATCACTTCACTGAAGAAGG - Intronic
940706564 2:157112178-157112200 CAGGATCACGTCACTGCACCTGG - Intergenic
941755973 2:169186379-169186401 CAGTGTGACATCACTGAACATGG + Intronic
942163116 2:173212861-173212883 CAGCAAAACATCACTGAAAAGGG + Intronic
943618748 2:190123678-190123700 CAGCATCATTTCACTGACAGGGG - Intronic
944581857 2:201138518-201138540 CATCATCACCTCACTGAGGAGGG + Intronic
946117543 2:217476594-217476616 CAGCATAATGTCACTGAATATGG + Intronic
946706130 2:222460544-222460566 CAGCAGCACATCTCTGATCATGG + Intronic
947122632 2:226833764-226833786 CAGCATCCTTTCACTGAGCAAGG - Intergenic
947214134 2:227734962-227734984 CTCCATTACTTCACTGAACTCGG - Intergenic
948068398 2:235100044-235100066 CTGCATCTCCTCATTGAACAGGG - Intergenic
948252559 2:236542212-236542234 CAACATGATGTCACTGAACATGG - Intergenic
1169217835 20:3803678-3803700 CAGCCCCACTTCACTGTGCATGG + Intronic
1170072009 20:12379534-12379556 CTACCTCACTTCACTGTACAAGG - Intergenic
1170915594 20:20621363-20621385 CACCATGACATCAGTGAACATGG - Intronic
1171212245 20:23325969-23325991 GACCATCAATGCACTGAACATGG + Intergenic
1173893720 20:46533960-46533982 CCACTTCACTTCACTGAACTTGG + Intergenic
1175342658 20:58244013-58244035 CAGCATGGTATCACTGAACAAGG + Intergenic
1180921738 22:19524802-19524824 CAGCTCCACTTCCCTGACCAAGG + Intronic
951160364 3:19412301-19412323 CAGCACCATTTTACTGAATAGGG - Intronic
952663884 3:35881010-35881032 CAGCAGCTTTTCAGTGAACATGG + Intergenic
953167930 3:40481966-40481988 CAGCATCACCTCCCTGTATAGGG - Exonic
953171480 3:40511546-40511568 CAGCATCACTTCCCTGTACAGGG - Exonic
953173589 3:40529395-40529417 CAGCATCACCTCCCCGTACAGGG - Exonic
953439882 3:42908098-42908120 CAGCATCACATCCCTGTACAGGG - Exonic
953443502 3:42941302-42941324 CAGCATCACATCCCTGTACAAGG - Exonic
953568743 3:44054777-44054799 AAGCAACACTTTACTGAAAAAGG - Intergenic
953632735 3:44632549-44632571 CAGCATCACATCCCAGTACAAGG - Exonic
957092159 3:75741638-75741660 CAGCATCACGTCCCTGTACAGGG + Exonic
957092181 3:75741767-75741789 CAGCATCACGTTCCTGTACAGGG + Intronic
957842606 3:85691193-85691215 CTGCCTTACTTCACTGAACATGG + Intronic
958057128 3:88427556-88427578 AAGCATCAGTGCACTGAGCATGG - Intergenic
958784675 3:98584772-98584794 CAGGCTCACTGCACAGAACAGGG + Intronic
961675584 3:128563593-128563615 CAACATGACGTCACTGAACAGGG + Intergenic
961880350 3:130057217-130057239 CACCATCACCTCTCTGCACAGGG - Intergenic
962343625 3:134604635-134604657 CAATATGACTTCACTGAGCATGG + Intronic
963667403 3:148206291-148206313 CAGTAACACTGCACTGCACATGG + Intergenic
968992736 4:3925571-3925593 CACCATCACCTCTCTGCACAGGG - Intergenic
971420520 4:26469993-26470015 CAGCATGGCCTCATTGAACAGGG - Intergenic
972861409 4:43173424-43173446 CAACATCATTATACTGAACAGGG + Intergenic
972870774 4:43294650-43294672 CAGCATCAGTTGTCTGAACTAGG + Intergenic
973022460 4:45220461-45220483 CAGCTTGACTTCAGTGAAGATGG - Intergenic
973316544 4:48766471-48766493 CTGCATCACATCCCTGCACAAGG - Intronic
975780905 4:77838774-77838796 CAGCATCCTTTCACAGAATAGGG + Intergenic
976076506 4:81305150-81305172 CAACATAATGTCACTGAACACGG - Intergenic
976916100 4:90376366-90376388 CAGCCTCAATTAACTGGACATGG + Intronic
977896109 4:102367089-102367111 CAGCACCATTTTACTGAATAGGG - Intronic
978484119 4:109230362-109230384 CAGCATTACATCACTGAAAAAGG - Intronic
979717845 4:123863032-123863054 CACTAGCAATTCACTGAACAAGG - Intergenic
981350187 4:143720497-143720519 CAGCTCCACTTCACCTAACATGG - Intergenic
981707686 4:147678818-147678840 CTGCGTGACTTCACTGAAAAAGG + Intronic
982239247 4:153282159-153282181 CAGCATCATCTCACTGGAGATGG + Intronic
984980666 4:185277543-185277565 CAGCATGACGTCACTGAACGTGG + Intronic
986536689 5:8795146-8795168 GAACAGCACTTCAATGAACATGG + Intergenic
991348345 5:65694071-65694093 CAGCACCACTCCACAGGACACGG + Intronic
992482411 5:77165090-77165112 CAGCGTGATGTCACTGAACATGG + Intergenic
993028556 5:82675193-82675215 CAGAAACACTTCACTAAATACGG + Intergenic
994086208 5:95762132-95762154 CAACATGACATCACAGAACAAGG - Intronic
994119682 5:96100041-96100063 CACCATCCCAACACTGAACAAGG - Intergenic
995449647 5:112286520-112286542 CTTCATTACTTCACTGAAAATGG + Intronic
996199753 5:120657407-120657429 CAACATGAGGTCACTGAACATGG - Intronic
997885477 5:137626104-137626126 CAGGATCATTTCTCTGACCAGGG + Intronic
999046094 5:148471330-148471352 CAGAATTATTTCACTCAACAGGG - Intronic
999353276 5:150898456-150898478 CAGCATCACATCCCTGTACAGGG + Exonic
999356811 5:150942578-150942600 CAGCATCACATCCCTGTACAGGG + Intergenic
1002149120 5:177212311-177212333 AATCATCACTTCAATGAAGAAGG + Intronic
1002395097 5:178946435-178946457 CAGCATCACGTCCCTGTACAGGG - Exonic
1002405560 5:179027549-179027571 CAGCATCACCTCCCGGTACAAGG - Exonic
1002411011 5:179076521-179076543 CAGCATCACCTCCCGGTACAAGG - Exonic
1003317246 6:5024040-5024062 CATCCTCCCTCCACTGAACATGG + Intergenic
1004732116 6:18368097-18368119 CATCATCACCTCACTGAGGAGGG + Intergenic
1007092158 6:39191114-39191136 CAGCATCACCTTCGTGAACACGG - Exonic
1007144634 6:39616030-39616052 CACCATTACTTCACTGAAACAGG + Intronic
1008595433 6:53037159-53037181 AAGCACCACTCCACTGCACAAGG + Intronic
1009635210 6:66256605-66256627 CAGCAGCACTGCAATAAACATGG - Intergenic
1011167454 6:84464994-84465016 CAAAATGAATTCACTGAACATGG - Intergenic
1011883169 6:92057917-92057939 CAGGAATACTTCTCTGAACAGGG + Intergenic
1014309949 6:119787359-119787381 CAGCATCATTCCCCTGAACAGGG - Intergenic
1016494292 6:144642485-144642507 CAGCACAACTTATCTGAACAAGG - Intronic
1017262692 6:152405386-152405408 CAACATGACGTCACAGAACATGG + Intronic
1017701391 6:157076043-157076065 CAGCAACATTTCACATAACATGG - Intronic
1018345001 6:162891179-162891201 CAGCAGCACTGCACTTTACATGG + Intronic
1018352336 6:162973104-162973126 CAGCATCACTTTACCGTACTAGG - Intronic
1020315386 7:6901925-6901947 CACCATCGCTTCTCTGCACAGGG - Intergenic
1020639709 7:10740147-10740169 AAGTATAACTTCACTGAAAATGG - Intergenic
1020920879 7:14262834-14262856 CAGCAGCAGTAAACTGAACAAGG + Intronic
1021075974 7:16305267-16305289 TAGCATCACCTCAGTTAACAGGG + Intronic
1021213205 7:17882248-17882270 CAGCATGAAGTCACTGAACATGG - Intronic
1021703470 7:23343079-23343101 CAGCACCATTTCACTGATTAAGG + Intronic
1023777789 7:43625689-43625711 TAGCATCTTTTCACTGACCAAGG - Exonic
1027469034 7:78550614-78550636 CTGCATAACTCCACTGGACAAGG + Intronic
1029293429 7:99519881-99519903 CAGCTTCACTTCTCTCAACTGGG + Exonic
1030115283 7:106058286-106058308 CAGCATCACTTCTCTTATCCCGG + Intergenic
1031152306 7:118068461-118068483 CAGCATCATTTCAATTAAAATGG - Intergenic
1032906829 7:136377859-136377881 CAGCTTCACTTCACAGGATAAGG - Intergenic
1033554434 7:142476464-142476486 CAGCATGGCTTCACTGAACAGGG - Intergenic
1033559063 7:142514007-142514029 CAGCATGGCTTCACTGAACAGGG - Intergenic
1036084799 8:5601727-5601749 CAGCATCACTTTACAGATGATGG + Intergenic
1039772061 8:40697389-40697411 CGGCATCACTTCCCTGCGCAGGG + Exonic
1040710042 8:50176956-50176978 CACCTTCTCTTGACTGAACAGGG - Intronic
1042344433 8:67712845-67712867 CAGCATCCCCACACTGTACACGG + Intronic
1044757431 8:95479390-95479412 CAGTATGACTTCACTGAAATGGG + Intergenic
1045474087 8:102538381-102538403 CAGCATCACTTCACTGAACATGG + Intronic
1045528742 8:102963947-102963969 CAACATGATGTCACTGAACACGG - Intronic
1045561465 8:103267930-103267952 CAGTATCACTTCCTTGAGCAAGG - Intergenic
1047275305 8:123401093-123401115 CATCATCACCTCACTGAGGAGGG - Intronic
1049850896 8:144829554-144829576 CAGCATCACTTCCCTGTAGAGGG - Exonic
1057267938 9:93631138-93631160 CAGCCTCAGCTCACAGAACAGGG - Intronic
1057350390 9:94292417-94292439 CAGCATCACCTCCCTGTACAGGG - Exonic
1057632227 9:96729181-96729203 CAGCACCACGTCTCTGTACAGGG - Intergenic
1057642945 9:96844918-96844940 CAGCATCACATCTCTGTACAGGG + Exonic
1058300455 9:103365013-103365035 CAGCATCACTACATTGGTCAAGG + Intergenic
1062701548 9:137908121-137908143 CAGCATCGCTTGACTGTTCATGG + Intronic
1203485594 Un_GL000224v1:51109-51131 CACCATCACGTCCCTGTACAGGG - Intergenic
1185566263 X:1097674-1097696 CAGCATCACCTCACAGTCCAAGG - Intergenic
1187789510 X:22934386-22934408 CAGCATTATATCACTGAATATGG + Intergenic
1188748586 X:33877864-33877886 CAGCATCACTATTCTGAGCATGG - Intergenic
1189557389 X:42159469-42159491 CACCATCACAACACTGAACTGGG - Intergenic
1190155013 X:47983313-47983335 CAGCATCACGTCTCTGTACAGGG + Exonic
1194593540 X:95831066-95831088 CAGCACCAGTTAACTGAATAGGG + Intergenic
1198107870 X:133478061-133478083 CTGCAGCACTTCTCTAAACAAGG - Intergenic
1198226376 X:134649433-134649455 CGACATGACATCACTGAACAAGG - Intronic
1199501478 X:148511625-148511647 AAACATCACCTCATTGAACAAGG + Intronic