ID: 1045476966

View in Genome Browser
Species Human (GRCh38)
Location 8:102561357-102561379
Sequence GGTTTTACTGGACAATGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045476963_1045476966 -2 Left 1045476963 8:102561336-102561358 CCTCGAGCACAGTGGGATTGTGG No data
Right 1045476966 8:102561357-102561379 GGTTTTACTGGACAATGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045476966 Original CRISPR GGTTTTACTGGACAATGATC AGG Intergenic
No off target data available for this crispr