ID: 1045477382

View in Genome Browser
Species Human (GRCh38)
Location 8:102564781-102564803
Sequence CCACCCAGGTAGATGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045477382_1045477395 6 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477395 8:102564810-102564832 GGAATGGGGGTGACTCTTGAAGG No data
1045477382_1045477394 -7 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477394 8:102564797-102564819 TGGGTGGGAGATGGGAATGGGGG No data
1045477382_1045477393 -8 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477393 8:102564796-102564818 CTGGGTGGGAGATGGGAATGGGG No data
1045477382_1045477396 25 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477396 8:102564829-102564851 AAGGTGCAGAAGTGAGAAATCGG No data
1045477382_1045477392 -9 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477392 8:102564795-102564817 CCTGGGTGGGAGATGGGAATGGG No data
1045477382_1045477390 -10 Left 1045477382 8:102564781-102564803 CCTGACCCCATCTACCTGGGTGG No data
Right 1045477390 8:102564794-102564816 ACCTGGGTGGGAGATGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045477382 Original CRISPR CCACCCAGGTAGATGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr