ID: 1045478370

View in Genome Browser
Species Human (GRCh38)
Location 8:102572830-102572852
Sequence CTGTTAGAGGGAATGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045478365_1045478370 -2 Left 1045478365 8:102572809-102572831 CCATATTAATGTAAGATGATACT No data
Right 1045478370 8:102572830-102572852 CTGTTAGAGGGAATGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045478370 Original CRISPR CTGTTAGAGGGAATGGTGTT GGG Intergenic
No off target data available for this crispr