ID: 1045478766

View in Genome Browser
Species Human (GRCh38)
Location 8:102576064-102576086
Sequence CCCGTGGGGTACCCATAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045478760_1045478766 8 Left 1045478760 8:102576033-102576055 CCATTTCAAAAAAAAACGAACAT No data
Right 1045478766 8:102576064-102576086 CCCGTGGGGTACCCATAGCTGGG No data
1045478759_1045478766 29 Left 1045478759 8:102576012-102576034 CCTGGGTGACAGAACGAGACTCC 0: 467
1: 14464
2: 68472
3: 115705
4: 142163
Right 1045478766 8:102576064-102576086 CCCGTGGGGTACCCATAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045478766 Original CRISPR CCCGTGGGGTACCCATAGCT GGG Intergenic
No off target data available for this crispr