ID: 1045479803

View in Genome Browser
Species Human (GRCh38)
Location 8:102582845-102582867
Sequence AAGAGCTTTCAAATTGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045479797_1045479803 18 Left 1045479797 8:102582804-102582826 CCTCTTTCACTGTGTACAAGGCC No data
Right 1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG No data
1045479801_1045479803 -3 Left 1045479801 8:102582825-102582847 CCGTTCCAAGCTGAGGAGGGAAG No data
Right 1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG No data
1045479795_1045479803 26 Left 1045479795 8:102582796-102582818 CCACATTTCCTCTTTCACTGTGT No data
Right 1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG No data
1045479802_1045479803 -8 Left 1045479802 8:102582830-102582852 CCAAGCTGAGGAGGGAAGAGCTT No data
Right 1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045479803 Original CRISPR AAGAGCTTTCAAATTGAACC AGG Intergenic
No off target data available for this crispr