ID: 1045482111

View in Genome Browser
Species Human (GRCh38)
Location 8:102600897-102600919
Sequence GCATTGAGCCCCTTCTAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482111_1045482119 29 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482111_1045482120 30 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482111_1045482115 8 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482115 8:102600928-102600950 GTTGCCGCAAATCTAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482111 Original CRISPR GCATTGAGCCCCTTCTAGGA CGG (reversed) Intergenic
No off target data available for this crispr