ID: 1045482112

View in Genome Browser
Species Human (GRCh38)
Location 8:102600901-102600923
Sequence AGAGGCATTGAGCCCCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482112_1045482115 4 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482115 8:102600928-102600950 GTTGCCGCAAATCTAACCCTAGG No data
1045482112_1045482119 25 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482112_1045482120 26 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482112 Original CRISPR AGAGGCATTGAGCCCCTTCT AGG (reversed) Intergenic
No off target data available for this crispr