ID: 1045482114

View in Genome Browser
Species Human (GRCh38)
Location 8:102600919-102600941
Sequence AGATTTGCGGCAACACCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482114_1045482120 8 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482120 8:102600950-102600972 GATGCCTTTCTTATTAAAGCGGG No data
1045482114_1045482123 22 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482123 8:102600964-102600986 TAAAGCGGGAAACTTCTGCAGGG No data
1045482114_1045482126 30 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482126 8:102600972-102600994 GAAACTTCTGCAGGGGCCACGGG No data
1045482114_1045482122 21 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482122 8:102600963-102600985 TTAAAGCGGGAAACTTCTGCAGG No data
1045482114_1045482119 7 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482119 8:102600949-102600971 GGATGCCTTTCTTATTAAAGCGG No data
1045482114_1045482124 23 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482124 8:102600965-102600987 AAAGCGGGAAACTTCTGCAGGGG No data
1045482114_1045482125 29 Left 1045482114 8:102600919-102600941 CCTCTCGGTGTTGCCGCAAATCT No data
Right 1045482125 8:102600971-102600993 GGAAACTTCTGCAGGGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482114 Original CRISPR AGATTTGCGGCAACACCGAG AGG (reversed) Intergenic
No off target data available for this crispr