ID: 1045482115

View in Genome Browser
Species Human (GRCh38)
Location 8:102600928-102600950
Sequence GTTGCCGCAAATCTAACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045482111_1045482115 8 Left 1045482111 8:102600897-102600919 CCGTCCTAGAAGGGGCTCAATGC No data
Right 1045482115 8:102600928-102600950 GTTGCCGCAAATCTAACCCTAGG No data
1045482112_1045482115 4 Left 1045482112 8:102600901-102600923 CCTAGAAGGGGCTCAATGCCTCT No data
Right 1045482115 8:102600928-102600950 GTTGCCGCAAATCTAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045482115 Original CRISPR GTTGCCGCAAATCTAACCCT AGG Intergenic
No off target data available for this crispr